BBa_K1085008 1 BBa_K1085008 SilkTail Stop-codon 2013-09-09T11:00:00Z 2016-02-10T01:11:21Z The amino acid sequence of the tail was obtained from MaSp2. The DNA sequence was synthesized by Integrated DNA Technologies (IDT). This BioBrick contains the coding sequence for silk tail and ends with a stop codon. The Tail .... false false _1395_ 0 4206 16089 9 In stock false The DNA sequence was codon-optimized for Bacillus Subtilis. Moreover the nucleotide sequence was optimized in order to accomplish the production standard of IDT. A couple of optimized codons were affected by this. false Claudio Tiecher annotation2339058 1 spidersilk C-terminal domain range2339058 1 1 270 annotation2362390 1 Stop codon (TGA) range2362390 1 271 273 BBa_K1085008_sequence 1 gccccagttgcctccgcagccgcctcaaggctgtcctcccctcaagcctcctcccgtgtttcatccgccgtgtccactctcgtgtcctccggacctacgaatcctgccgccttatccaatgccatctccagcgttgtatcacaagtttcagcctccaatcctggactatccggatgtgacgttctcgttcaagccctcctcgaactcgtatccgccctcgtacacatcctcggctcctcctccattggacaaattaattacgccgcctcctga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z