BBa_I13453 1 BBa_I13453 Pbad promoter 2005-05-24T11:00:00Z 2015-08-31T04:07:34Z Released HQ 2013 PBad promoter from I0500 without AraC. false false _11_ 0 253 6 In stock false true jkm BBa_K1088024 1 Rubber Fuc HRT2 prenyltransferase from Hevea Brasilianis (ara promoter without araC: arabinose inducible) 2013-09-17T11:00:00Z 2015-05-08T01:09:06Z Source is specified in components This part encodes the rubberproducing prenyltransferase from the rubber tree Hevea brasiliensis. It uses isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP) as substrates to produce cis-1,4 polyisoprene natural rubber. The gene is expressed from the arabinose promoter (BBa_I13453), which is induceable with arabinose under glucose scarce conditions. Note that the regulater insn't a part of this part and thus no/very little transcription is expected. false false _1398_ 0 12807 9 It's complicated false There is a 3xFLAG-tag after the HRT2 stop codon, and thus the 3xFLAG-tag isn't translated. false Andreas Kj??r component2373586 1 BBa_I13453 component2373592 1 BBa_K1088025 component2373587 1 BBa_K1088021 component2373590 1 BBa_J15001 component2373591 1 BBa_K1088003 annotation2373592 1 BBa_K1088025 range2373592 1 1002 1067 annotation2373587 1 BBa_K1088021 range2373587 1 131 136 annotation2373591 1 BBa_K1088003 range2373591 1 147 1001 annotation2373590 1 BBa_J15001 range2373590 1 137 146 annotation2373586 1 BBa_I13453 range2373586 1 1 130 BBa_K1088003 1 HRT2 Cis-1,4-prenyltransferase obtained from Hevea brasiliensis cDNA 2013-07-09T11:00:00Z 2015-05-08T01:09:06Z The gene is synthesized by http://www.genscript.com/ This part encodes the rubberproducing prenyltransferase from the rubber tree Hevea brasiliensis. It uses isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP) as substrates to produce cis-1,4 polyisoprene natural rubber. The sequence have been optimized for E. coli codons. false false _1398_ 0 12807 9 In stock false We optimized codons to fit the most used codons of E. coli. false Andreas Kj??r, Patrick Rosendahl Andreassen BBa_K1088021 1 BBa_K1088021 Mixed site (ACTAGA) 2013-09-16T11:00:00Z 2015-05-08T01:09:06Z Restriction sites Mixed site (ACTAGA)when XbaI and SpeI sticky ends ligate false false _1398_ 0 17057 9 Not in stock false None false Patrick Rosendahl Andreassen BBa_J15001 1 BBa_J15001 strong synthetic E. coli ribosome binding site with SacI site. 2007-07-12T11:00:00Z 2015-08-31T04:08:32Z Synthetic. This is a strong synthetic E. coli ribosome binding site. It is synthesised as two complementary oligonucleotides rather than being incorporated into a biobrick plasmid. It incorporates a SacI site overlapping the XbaI site, which is preserved when it is added to any other biobrick. This allows easy detection of the RBS after it has been added upstream of a biobrick coding sequence in a plasmid vector. false false _163_ 0 837 163 Not in stock false Note the presence of a SacI site overlapping the XbaI site, which is preserved when this biobrick is added to any other biobrick. At the time of writing, this biobrick is added as a short piece of DNA composed of two complementary oligonucleotides rather than being incorporated into a biobrick cloning vector by itself. It can be added upstream of a biobrick coding sequence, and its presence can easily be detected in miniprep DNA on a gel by using a SacI-SpeI or similar digest. false Chris French annotation1938045 1 SacI range1938045 1 1 3 annotation1938046 1 rbs range1938046 1 4 10 BBa_K1088025 1 3xFLAG 3xFLAG 2013-09-17T11:00:00Z 2015-05-08T01:09:06Z Sigma Aldrich 3xFLAG tag that can be fused with proteins either at the C- or N-terminal end. It can be used to purify the tagged protein or check levels of expression of tagged protein. false false _1398_ 0 12807 9 Not in stock false None false Andreas Kj??r BBa_I13453_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagc BBa_K1088003_sequence 1 atggaattatacaacggtgaaaggccgagcgtgttcagactgctggggaaatatatgcgtaaaggcctgtatagcatcctgacccagggtccgatcccgacccatattgccttcatcctggatggtaacggtcgttttgcgaaaaaacataaactgccggaaggtggtggtcataaagcgggttttctggcgctgctgaacgtgctgacctattgctatgaactgggcgtgaaatatgcgactatctatgcctttagcatcgataactttcgtcgtaaaccgcatgaagttcagtacgtgatgaacctgatgctggaaaaaattgaaggtatgatcatggaagaaagcatcatcaacgcatatgatatttgcgtgcgttttgttggtaacctgaaactgctggatgaaccgctgaaaaccgcagcagataaaattatgcgtgcgaccgccaaaaactccaaatttgtgctgctgctggcggtgtgctacacctcaaccgatgaaatcgtgcatgcggttgaagaatcctctaaagataaactgaaatccgatgaaatttgcaacgatggcaacggcgattgtgtgattaaaattgaagaaatggaaccgtattctgaaatcaaactggtggaactggaacgtaacacctacattaacccgtatccggatgtgctgattcgtacctctggcgaaacccgtctgagcaactacctgctgtggcagaccaccaactgcattctgtattctccgcatgcgctgtggccggaaattggtctgcgtcacgtggtgtgggcggtgattaactgccagcgtcattattcttacctggaaaaacataaagaatacctgaaataa BBa_K1088024_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagcactagactcaaggaggatggaattatacaacggtgaaaggccgagcgtgttcagactgctggggaaatatatgcgtaaaggcctgtatagcatcctgacccagggtccgatcccgacccatattgccttcatcctggatggtaacggtcgttttgcgaaaaaacataaactgccggaaggtggtggtcataaagcgggttttctggcgctgctgaacgtgctgacctattgctatgaactgggcgtgaaatatgcgactatctatgcctttagcatcgataactttcgtcgtaaaccgcatgaagttcagtacgtgatgaacctgatgctggaaaaaattgaaggtatgatcatggaagaaagcatcatcaacgcatatgatatttgcgtgcgttttgttggtaacctgaaactgctggatgaaccgctgaaaaccgcagcagataaaattatgcgtgcgaccgccaaaaactccaaatttgtgctgctgctggcggtgtgctacacctcaaccgatgaaatcgtgcatgcggttgaagaatcctctaaagataaactgaaatccgatgaaatttgcaacgatggcaacggcgattgtgtgattaaaattgaagaaatggaaccgtattctgaaatcaaactggtggaactggaacgtaacacctacattaacccgtatccggatgtgctgattcgtacctctggcgaaacccgtctgagcaactacctgctgtggcagaccaccaactgcattctgtattctccgcatgcgctgtggccggaaattggtctgcgtcacgtggtgtgggcggtgattaactgccagcgtcattattcttacctggaaaaacataaagaatacctgaaataagactacaaagaccatgacggtgattataaagatcatgatatcgactacaaagatgacgacgataaa BBa_J15001_sequence 1 ctcaaggagg BBa_K1088021_sequence 1 actaga BBa_K1088025_sequence 1 gactacaaagaccatgacggtgattataaagatcatgatatcgactacaaagatgacgacgataaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z