BBa_K110013 1 BBa_K110013 Shortened Region Between-SWP82-W and EMP47-C LtR 2008-08-26T11:00:00Z 2015-05-08T01:09:09Z SGD This is the exact region between the end of the ORF of STE2-W and the beginning of BST1-C false false _201_ 0 2669 9 Not in stock false This was taken from the yeast genome false James DiCarlo BBa_K110013_sequence 1 aaagaagtaaaacataatgtagggaacactccaataagaaataaaccattgttgaagtagtaatataaactatcgttcgttattttataaaatatgtattgttacatatatatacatatatagggaatgcatgtgcacaattggtttgagtggaaggaataatccaaaat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z