BBa_K516030 1 BBa_K516030 mRFP protein generator TERM+ RBS+(B0030) 2011-09-07T11:00:00Z 2015-05-08T01:12:32Z Registry Released HQ 2013 mRFP protein generator TERM+ RBS+(B0030) false false _681_ 0 4150 9 In stock true -- false Nicolo' Politi, Federica Sampietro, Davide Bianchini component2250576 1 BBa_E1010 component2250572 1 BBa_B0030 component2250583 1 BBa_B0015 annotation2250572 1 BBa_B0030 range2250572 1 1 15 annotation2250576 1 BBa_E1010 range2250576 1 22 727 annotation2250583 1 BBa_B0015 range2250583 1 736 864 BBa_E1010 1 mRFP1 **highly** engineered mutant of red fluorescent protein from Discosoma striata (coral) 2004-07-27T11:00:00Z 2015-08-31T04:07:26Z Campbell et al., PNAS v99 p7877 <a href="http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=12060735">URL</a> Released HQ 2013 monomeric RFP: Red Fluorescent Protein. Excitation peak: 584 nm Emission peak: 607 nm false false _11_1_ 0 52 7 In stock false TAATAA double stop codon added (DE). Four silent mutations made to remove three EcoRI sites and one PstI site: A28G, A76G, A349G, G337A. true Drew Endy annotation1014044 1 mrfp1 range1014044 1 1 675 annotation2214014 1 Help:Barcodes range2214014 1 682 706 BBa_K145150 1 BBa_K145150 Hybrid promoter: HSL-LuxR activated, P22 C2 repressed 2008-08-05T11:00:00Z 2015-05-08T01:10:29Z Synthetic Hybrid promoter consisting of the Lux box which overlaps partly with -35 box. Binding sites for P22 C2 O_R2 and O_R1 are located between the -35 and -10 boxes and downstream of them respectively. false false _257_ 0 2970 9 It's complicated false -35 box is partly composite. -10 is taken from the P22 phage P_R regulatory region true Jonas Demeulemeester annotation1971586 1 OR1 range1971586 1 46 63 annotation1971583 1 -35 range1971583 1 20 25 annotation1971584 1 OR2 range1971584 1 23 40 annotation1971582 1 Lux-box range1971582 1 1 20 annotation1971585 1 -10 range1971585 1 42 47 BBa_K1106000 1 BBa_K1106000 mRFP generator under hybrid promoter: HSL-LuxR activated, P22 C2 repressed 2013-09-08T11:00:00Z 2015-05-08T01:09:10Z Completar Completar false false _1417_ 0 11811 9 It's complicated false Completar false Manuel Gim??nez component2337117 1 BBa_K145150 component2337131 1 BBa_K516030 annotation2337117 1 BBa_K145150 range2337117 1 1 66 annotation2337131 1 BBa_K516030 range2337131 1 75 938 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1702 1 RBS range1702 1 8 12 annotation1701 1 RBS-1\Strong range1701 1 1 15 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_E1010_sequence 1 atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc BBa_B0030_sequence 1 attaaagaggagaaa BBa_K516030_sequence 1 attaaagaggagaaatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1106000_sequence 1 acctgtaggatcgtacaggtttactaaagattcctttagtttataatttaagtgttctttaatttctactagagattaaagaggagaaatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K145150_sequence 1 acctgtaggatcgtacaggtttactaaagattcctttagtttataatttaagtgttctttaatttc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z