BBa_K1114017 1 BBa_K1114017 The MoClo format of BBa_J23115 with EB fusion sites. 2013-09-06T11:00:00Z 2015-05-08T01:09:11Z iGEM Distribution Kit ===Design Notes=== <html> This is the <a href="http://2013.igem.org/Team:BostonU/MoCloChara">MoClo</a> formatted part of BBa_J23115 with EB fusion sites. See the <a href="http://parts.igem.org/Part:BBa_J23115">BBa_J23115</a> page for full information on the part. This is a Level 0 MoClo part with flanking sites A on the 5' side and site B on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Summary of modifications from original part: Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. See <a href="http://parts.igem.org/Part:BBa_K783056">BBa_K783056 </a>. </html> ===Source=== iGEM Distribution Kit ===References=== false false _1425_ 0 17243 9 In stock false ===Design Notes=== <html> This is the <a href="http://2013.igem.org/Team:BostonU/MoCloChara">MoClo</a> formatted part of BBa_J23115 with EB fusion sites. See the <a href="http://parts.igem.org/Part:BBa_J23115">BBa_J23115</a> page for full information on the part. This is a Level 0 MoClo part with flanking sites A on the 5' side and site B on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Summary of modifications from original part: Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. See <a href="http://parts.igem.org/Part:BBa_K783056">BBa_K783056 </a>. </html> ===Source=== iGEM Distribution Kit ===References=== false Jake Awtry BBa_K1114017_sequence 1 gctttttatagctagctcagcccttggtacaatgctagctact igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z