BBa_K1114110 1 BBa_K1114110 Bicistronic design RBS 13, MoClo Format with BC fusion sites 2013-09-06T11:00:00Z 2015-05-08T01:09:11Z <html> This part was cloned off a BCD template from Sonya Iverson. Sonya Iverson based her designs for her BCD2 part off of a paper published by <a href= ???http://www.nature.com/nmeth/journal/v10/n4/full/nmeth.2404.html????>Mutalik, et al.</a> </html> <html> This is the <a href="http://2013.igem.org/Team:BostonU/MoCloChara">MoClo</a> formatted part of a bicistronic design ribosomal binding site 13 with BC fusion sites. This is a Level 0 MoClo part with flanking sites B on the 5' side and site C on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. See <a href=???http://parts.igem.org/Part:BBa_K783055???>BBa_K783055</a>. </html> false false _1425_ 0 8248 9 In stock false <html> This is the <a href="http://2013.igem.org/Team:BostonU/MoCloChara">MoClo</a> formatted part of a bicistronic design ribosomal binding site 13 with BC fusion sites. This is a Level 0 MoClo part with flanking sites B on the 5' side and site C on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. See <a href=???http://parts.igem.org/Part:BBa_K783055???>BBa_K783055</a>. </html> false Traci Haddock annotation2361884 1 BCD13 range2361884 1 5 88 annotation2361882 1 MoClo Fusion Site B range2361882 1 1 4 annotation2361883 1 MoClo Fusion Site C range2361883 1 89 92 BBa_K1114110_sequence 1 tactgggcccaagttcacttaaaaaggagatcaacaatgaaagcaattttcgtactgaaacatcttaatcatgcaatggaggctttctaatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z