BBa_K1114301 1 BBa_K1114301 This is MoClo formatted part of BBa_B0015 2013-09-06T11:00:00Z 2015-05-08T01:09:12Z iGEM kit This is a Level 0 MoClo part with flanking sites D on the 5' side and site G on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Summary of modifications from original part: Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. See <a href=???http://parts.igem.org/Part:BBa_ K1114409 ???>BBa_</a>. false false _1425_ 0 17246 9 In stock false This is a Level 0 MoClo part with flanking sites D on the 5' side and site G on the 3' side of the part. The fusion site letters refer to 4bp fusion sites: A = GGAG; B = TACT; C = AATG; D = AGGT; E = GCTT; F = CGCT; G = TGCC; H = ACTA. Summary of modifications from original part: Backbone is a modified version of pSB1C3 with added SpeI site in front of gene, BsaI sites flanking, and 4bp fusion sites. See <a href=???http://parts.igem.org/Part:BBa_ K1114409 ???>BBa_</a>. false Devina Desai annotation2362001 1 MoClo Fusion Site G range2362001 1 134 137 annotation2362002 1 BBa_B0015 range2362002 1 5 133 annotation2362000 1 MoClo Fusion Site D range2362000 1 1 4 BBa_K1114301_sequence 1 aggtccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatgcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z