BBa_K112226 1 BBa_K112226 {a~ompT} The ompT gene ready to attach rbs, BBb site 2008-10-20T11:00:00Z 2015-05-08T01:09:15Z Synthetic This part is in BBb Format. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BBb Format is available at: [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false false _224_ 0 2048 9 Not in stock false ? false Molly Allen BBa_K112226_sequence 1 acatatgcgggcgaaactcctaggaatagtcctgacaacccctatcgcgatcagctcttttgcgtcgacg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z