BBa_K112405 1 BBa_K112405 Promoter for CadA and CadB genes 2008-10-20T11:00:00Z 2015-05-08T01:09:17Z cloned from E. coli MG1655 genome located upstream of CadA and CadB genes Our microarray experiment showed that this gene was responsive to sound and ultrasound. Therefore, we cloned the promoter region located approximately 250 base pairs before the start codon for the cadB gene. false false _224_ 0 3241 9 It's complicated false There was a relatively high basal level of expression of this gene that made this part difficult to incorporate into our lysis device design. false Christina Brown BBa_K112405_sequence 1 ggtatattccagacttctgttccttatgttgtaccttatctcgacaaatttcttgcttcagaataagtaactccgggttgatttatgctcggaaatatttgttgttgagtttttgtatgttcctgttggtataatatgttgcggcaatttatttgccgcataatttttattacataaatttaaccagagaatgtcacgcaatccattgtaaacattaaatgtttatcttttcatgatatcaacttgcgatcctgatgtgttaataaaaaacctcaagttctcacttacagaaacttttgtgttatttcacctaatctttaggattaatccttttttcgtgagtaatcttatcgccagtttggtctggtca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z