BBa_K112601 1 BBa_K112601 < AP tag ! in BBb 2008-09-02T11:00:00Z 2015-05-08T01:09:18Z Construction of {<AP!} basic part K112601 Wobble PCR SC001/SC003 (69 bp, EcoRI/BamHI) Sub into pBca1256 (EcoRI/BamHI, 2472+ 910) Product is pBca1256-K112601 -------------------------------------------------- SC001 Forward Biobricking of <AP-tag! cgataGAATTCatgAGATCTggcctgaacgatatttttgaagcgcag SC003 Reverse Biobricking of <AP-tag! ccagtGGATCCttattcatgccattcaattttctgcgcttcaaaaatatcg This is an AP tag with stop codon, but no start. ---- This part is in BBb Format. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BBb Format is available at:<br> [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false false _224_ 0 3386 9 It's complicated true N/A false Sherine Cheung BBa_K112709 1 BBa_K112709 b1006 2008-10-20T11:00:00Z 2015-05-08T01:09:18Z <pre> Construction of <b1006> basic part K112709 Wobble PCR of dv021/dv022 (66bp, EcoRI/BamHI/DpnI) Sub into pBca1256 (EcoRI/BamHI, 2472+66, L) Product is pBca1256-K112709 ----------------------------------------------- dv021 Forward biobricking of b1006 cgataGAATTCatgAGATCTaaaaaaaaaccccgcccctgacagggcgg dv022 Reverse biobricking of b1006 GGATCCtaaaaaaaaccccgccctgtcaggggcggggtttttt </pre> The b1006 terminator. ---- This part is in BBb Format. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BBb Format is available at:<br> [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false true _224_ 0 2998 9 Not in stock false false Bing Xia BBa_K112617 1 BBa_K112617 < HA!.b1006 in BBb 2008-10-21T11:00:00Z 2015-05-08T01:09:18Z K112601 assembled with K112709 This is a composite part. AP tag with no start but a stop codon is the lefty parent of the part; terminator b1006 is the righty parent of the part. It is in BBb format. ---- This part is in BBb Format. It is flanked by BamHI and BglII sites instead of XbaI and SpeI. More information about the BBb Format is available at:<br> [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page] false false _224_ 0 3386 9 Not in stock false N/A false Sherine Cheung component1984050 1 BBa_K112709 component1984049 1 BBa_K112999 component1984048 1 BBa_K112601 annotation1984050 1 BBa_K112709 range1984050 1 55 94 annotation1984048 1 BBa_K112601 range1984048 1 1 48 annotation1984049 1 BBa_K112999 range1984049 1 49 54 BBa_K112999 1 scar BBb1 scar sequence 2008-10-20T11:00:00Z 2015-05-08T01:09:20Z This is the scar sequence of the BBb1 assembly scheme. For more information, refer to [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb Standard Description Page]. false false _224_ 0 2998 9 Not in stock false false Bing Xia BBa_K112709_sequence 1 aaaaaaaaaccccgcccctgacagggcggggtttttttta BBa_K112617_sequence 1 ggcctgaacgatatttttgaagcgcagaaaattgaatggcatgaataaggatctaaaaaaaaaccccgcccctgacagggcggggtttttttta BBa_K112999_sequence 1 ggatct BBa_K112601_sequence 1 ggcctgaacgatatttttgaagcgcagaaaattgaatggcatgaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z