BBa_K1129040 1 BBa_K1129040 Arab.+rbs+AtCCR1+term 2013-09-15T11:00:00Z 2015-05-08T01:09:19Z genomic Arab.+rbs+AtCCR1+term false false _1441_ 0 9774 9 In stock false Arab.+rbs+AtCCR1+term false Joe Ho annotation2348818 1 BBa_J23118 range2348818 1 1 35 BBa_K1129040_sequence 1 ttgacggctagctcagtcctaggtattgtgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z