BBa_K113010 1 BBa_K113010 overlapping T7 promoter 2008-10-25T11:00:00Z 2015-05-08T01:09:20Z The sequence of T7 promoter is TAATACGACTCACTATA. Two T7 promoters are reversely overlapping. false false _254_ 0 2711 9 It's complicated false It is difficult to make this short DNA by PCR as both sides are T7 promoters, which are very similar. It is highly possible that they form loops before they can be synthesized by PCR. Thus we order two single stranded DNA and then anneal them together by touchdown PCR. false Wu Jingjing, Wang Jinyu annotation1989277 1 T7 promoter range1989277 1 4 21 annotation1989307 1 T7 promoter range1989307 1 20 37 BBa_K113010_sequence 1 cccctatagtgagtcgtattaatacgactcactatagggg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z