BBa_K1139200 1 PphoA <i>phoA</i> promoter 2013-09-23T11:00:00Z 2015-05-08T01:09:22Z The sequence is amplified from E. coli(MG1655) by PCR. <i>phoA</i> promoter is repressed by high concentration phosphate. false false _1451_ 0 16612 9 Not in stock false No false Sara Ogino annotation2360449 1 -35 range2360449 1 23 28 annotation2360251 1 phoB-Phosphorylated binding site range2360251 1 21 39 annotation2360448 1 -10 range2360448 1 48 53 BBa_K1139200_sequence 1 aaagttaatcttttcaacagctgtcataaagttgtcacggccgagacttatagtcgctttgtttttattttttaatgtatt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z