BBa_K1141001 1 BBa_K1141001 Plac-RBS-KillerRed (IPTG-inducible, pQE30 plasmid format) 2013-09-22T11:00:00Z 2015-05-08T01:09:23Z The source of this part is the pQE30 plasmid from QIAGEN (for PLac-RBS) and the KillerRed sequence from INVITROGEN. KillerRed was originally engineered from the anm2cp anthomedusa chromoprotein by Maria E. Bulina et al. This biobrick contains the PLac and RBS sequences from QIAGEN's pQE30 plasmid in front of the red fluorescent protein KillerRed. KillerRed has an additional function as a photosensitizer and the protein can be used to kill cells if illuminated by strong light while expressing KillerRed. KillerRed's presence in a culture can be seen (red colour similar to RFP), and the level of fluorescence corresponds to the amount of protein. Fluorescence peaks are 535 nm for absorption and 610 nm for emission. The protein dimerizes with itself and is not suitable for protein fusions. false false _1453_ 0 16838 9 It's complicated false None false Adrien Rapeaux annotation2358992 1 Eco RI range2358992 1 82 87 annotation2358996 1 Bam HI range2358996 1 139 144 annotation2358993 1 RBS range2358993 1 95 98 annotation2358995 1 ATG range2358995 1 109 111 annotation2358998 1 6x Histidine range2358998 1 121 138 annotation2358989 1 PLac range2358989 1 1 81 annotation2358997 1 KillerRed range2358997 1 145 861 BBa_K1141001_sequence 1 aaatcataaaaaatttatttgctttgtgagcggataacaattataatagattcaattgtgagcggataacaatttcacacagaattcattaaagaggagaaattaactatgagaggatcgcatcaccatcaccatcacggatccatgggttcagagggcggccccgccctgttccagagcgacatgaccttcaaaatcttcatcgacggcgaggtgaacggccagaagttcaccatcgtggccgacggcagcagcaagttcccccacggcgacttcaacgtgcacgccgtgtgcgagaccggcaagctgcccatgagctggaagcccatctgccacctgatccagtacggcgagcccttcttcgcccgctaccccgacggcatcagccatttcgcccaggagtgcttccccgagggcctgagcatcgaccgcaccgtgcgcttcgagaacgacggcaccatgaccagccaccacacctacgagctggacgacacctgcgtggtgagccgcatcaccgtgaactgcgacggcttccagcccgacggccccatcatgcgcgaccagctggtggacatcctgcccaacgagacccacatgttcccccacggccccaacgccgtgcgccagctggccttcatcggcttcaccaccgccgacggcggcctgatgatgggccacttcgacagcaagatgaccttcaacggcagccgcgccatcgagatccccggcccacacttcgtgaccatcatcaccaagcagatgagggacaccagcgacaagcgcgaccacgtgtgccagcgcgaggtggcctacgcccacagcgtgccccgcatcaccagcgccatcggtagcgacgaggat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z