BBa_K115006 1 BBa_K115006 Temperature sensitive 5 2008-07-28T11:00:00Z 2015-05-08T01:09:28Z Salmonella Enterica Tyhpy (CP000886.1) This part works as a thermoswitch the same as BBa_K115002. At low temperatures the RNA is folded into a structure that inhibits the Shine Dalgarno sequence. When the temperature rises, the RNA unfolds and the Shine Dalgarno sequence becomes exposed so that translation of the protein following this RNA can initiate. true false _223_ 0 3006 9 Discontinued false In contrast to BBa_K115002 a His-tag is added at the 3' end of the thermoswitch. We did this to shift the scar forward, otherwise the scar would alter the original RNA sequence. In case of part BBa_K115002 we left the scar inside the thermoswitch and altered the sequence in such a way that the predicted secundary structure remained the same. false Bastiaan van den Berg annotation1969135 1 SD range1969135 1 47 52 annotation1969136 1 His-tag range1969136 1 65 94 annotation1969134 1 start range1969134 1 59 61 BBa_K115006_sequence 1 ggacaagcaatgcttgccttgatgttgaacttttgaatagtgattcaggaggttaatgatgggccatcatcatcatcatcatcatcatcatcacagcagcggccatatcgaaggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z