BBa_K115008 1 BBa_K115008 RNA thermometer (ROSE) 2008-08-17T11:00:00Z 2015-05-08T01:09:28Z This sequence is taken from the Bradirhizobium Japonicum (BA000040.) as the 5'UTR (ROSE) of a heat shock protein. This is a RNA-thermometer derived from ROSE (BBa_K115001), to check effect of small changes in RNA-sequence on temperature sensitivity false false _223_ 0 3007 9 In stock true A few nucleotides have been altered true O.M.J.A. Stassen annotation1971991 1 Predicted stem loop range1971991 1 1 15 annotation1971995 1 SD range1971995 1 89 95 annotation1971993 1 Predicted stem loop range1971993 1 38 71 annotation1971994 1 Predicted stem loop extending to start codon range1971994 1 71 96 annotation1971996 1 Scar adaptation range1971996 1 74 80 annotation1971992 1 Predicted stem loop range1971992 1 15 36 BBa_K115008_sequence 1 gccgcgacaagcggtccgggcgccctaggggcccggcggagacgggcgccggaggtgtccgacgcctgctcgtcaagtacttgctccttggaggat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z