BBa_K115017 1 BBa_K115017 RNA thermometer (ROSE 32??C) 2008-08-19T11:00:00Z 2015-05-08T01:09:28Z Based on ROSE RNA thermometer sequences from Rfam database. Released HQ 2013 An RNA thermometer that theoretically switches on translation at 32 degrees Celcius and switched of translation below that temperature. Still to be tested. false false _223_ 0 3006 9 In stock true a lot, will be added soon. true Bastiaan van den Berg annotation1972920 1 SD range1972920 1 77 82 BBa_K115017_sequence 1 ccgggcgcccttcgggggcccggcggagacgggcgccggaggtgtccgacgcctgctcgtccagtctttgctcagtggaggat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z