BBa_K1157000 1 pPQS promoter sequence for PQS quorum sensing 2013-08-22T11:00:00Z 2015-05-08T01:09:30Z It comes from Psuedomonas Aeruginosa strain ATCC 27853 genomic sequence. This is a quorum sensing promoter sequence for PQS transcriptional regulator. The sequence is a 391 bp sequence that is cloned from Psuedomonas Aeruginosa strain ATCC 27853. It is similar to the LuxR-pLux system, and can be used to sense quorum sensing molecules. It is added into one of our constructs for quorum sensing biosensors that is targeted for 2-heptyl-3,4-dihydroxyquinoline. false false _1469_ 0 16435 9 In stock false This is almost the identical sequence as the genome in the bacterium. false Lin Ang Chieh BBa_K1157000_sequence 1 gggtgtgccaaatttctcgcggtttggttcgcgccgattgccgcggcctacgaagcccgtggttcttctccccgaaactttttcgttcggactccgaatatcgcgcttcgcccagcgccgctagtttcccgttcctgacaaagcaagcgctctggctcaggtatctcctgatccggatgcatatcgctgaagagggaacgttctgtcatgtccacattggccaacctgaccgaggttctgttccgcctcgatttcgatcccgataccgccgtttatcactatcggggccagactctcagccggctgcaatgccggacctacattctctcccaggccagcca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z