BBa_K117010 1 BBa_K117010 pLsrA-celE7-double Terminator 2008-10-07T11:00:00Z 2015-05-08T01:09:34Z to be updated This part is induced by AI-2 to produce lysis protein. The protein causes the host cell to lyze. false false _209_ 0 2774 9 It's complicated true to be updated true Nguyen Xuan Hung component1979994 1 BBa_K117002 component1979998 1 BBa_B0012 component1979995 1 BBa_K117000 component1979996 1 BBa_B0010 annotation1979998 1 BBa_B0012 range1979998 1 349 389 annotation1979996 1 BBa_B0010 range1979996 1 261 340 annotation1979994 1 BBa_K117002 range1979994 1 1 102 annotation1979995 1 BBa_K117000 range1979995 1 109 252 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_K117002 1 BBa_K117002 LsrA promoter (indirectly activated by AI-2) 2008-10-06T11:00:00Z 2015-05-08T01:09:34Z to be updated Released HQ 2013 The regulatory network for the uptake of Escherichia coli autoinducer 2 (AI-2) is comprised of a transporter complex, LsrABCD; its repressor, LsrR; and a cognate signal kinase, LsrK. This network is an integral part of the AI-2 quorum-sensing (QS) system. Once uptaken into the cell, AI-2 will be phosphorylated under the effect of LsrK. Without the presence of AI-2, LsrA promoter is inhibited by the repressor, LsrR. Phosphorylated AI-2 will prevent LsrR from inhibiting this promoter, hence activating it so that the downstream sequence can be expressed. To prevent the cell from self-inducing this promoter, we must suppress its AI-2 producing capability. It can be done by knocking out LuxS, one of the vital gene required for producing AI-2. By doing that, LsrA promoter can only be activated under the presence of AI-2 from other sources than the host cell which is LuxS mutant (say, by contact with normal cells). More information on AI-2 quorum-sensing (QS) system please refer to: http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1952038 false false _209_ 0 2774 9 In stock true to be updated true Nguyen Xuan Hung annotation1979372 1 RBS BBa_B0034 range1979372 1 112 123 BBa_K117000 1 BBa_K117000 Lysis gene (promotes lysis in colicin-producing bacteria strain) 2008-10-06T11:00:00Z 2015-05-08T01:09:34Z to be updated Released HQ 2013 This lysis gene encodes for the lysis protein in colicin-producing strains of bacteria. Once activated, it causes the host cell to lyze. It also removes the immunity protein out of colicin, and hence, activates the endonuclease activity of the colicin. false false _209_ 0 2774 9 In stock true to be updated true Nguyen Xuan Hung BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K117000_sequence 1 atgaaaaaaataacagggattattttattgcttcttgcagccattattcttgctgcatgtcaggcaaactatatccgtgatgttcagggcgggacagtatcaccgtcgtcaactgctgaactgaccggagtggaaacgcagtaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K117010_sequence 1 cacaacatcaactgagtgcatgccttatttaatcatgtaactattcttacgacttcaaacgtcaaacagtcttaacacttatttaattaaaaagaggagaaatactagatgaaaaaaataacagggattattttattgcttcttgcagccattattcttgctgcatgtcaggcaaactatatccgtgatgttcagggcgggacagtatcaccgtcgtcaactgctgaactgaccggagtggaaacgcagtaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K117002_sequence 1 cacaacatcaactgagtgcatgccttatttaatcatgtaactattcttacgacttcaaacgtcaaacagtcttaacacttatttaattaaaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z