BBa_K1173502 1 BBa_K1173502 <i>ompC</i> w/GFP + (<i>BglII+BamHI</i>)restriction sites 2013-09-19T11:00:00Z 2015-05-08T01:09:35Z Synthesised by IDT (gBlocks). Based on a variety of BioBricks. ompF is a specific promoter which is only activated when phosphorylated OmpR (OmpR-P) is present. OmpR is phosphorylated by the protein Cph8 (form by two proteins, Cph1 and EnvZ), which is usually associated with osmotic regulation. Cph8 is also responsive to red light; exposure to red light halts the phosphorylation of OmpR. The lack of OmpR-P means the ompF promoter is not actiavted, so the genes which follow it are not transcribed. There is a GFP after ompF, which has the nucleotide sequence from BBa_E0040. The GFP will be produced in most generally used competant cells, as Cph8 is present in their outer membranes for osmotic regulation. To control the levels of GFP produced, we recommend the use of EnvZ deficient cells and introducing the genes which code for Cph8 on a LCN plasmid. This would allow control of GFP production using only red light. However, the novel concept of this part is that you may replace GFP with a gene of your choice. The GFP is flanked by restriction sites for BglII and BamHI. This allows you to "cut out" the GFP without interfering with the standard 3A assembly (EcoRI, XbaI, SpeI and PstI) and replace it with any gene, providing it also has the BglII and BamHI restriction sites. These can easily be added using traditional cloning using PCR primers. This will theoretically allow any gene to be controlled by the ompF promoter, and therefore exposure to red light. false false _1486_ 0 18234 9 It's complicated false You MUST be concious of the BglII and BamHI cut sites within the construct. These enzymes are used for several assembly techniques, so these must not be applied when assembling the part with others. false paul james component2366891 1 BBa_M31985 component2366888 1 BBa_R0084 component2366894 1 BBa_K150008 component2366893 1 BBa_E0040 component2366890 1 BBa_B0034 component2366901 1 BBa_B0015 annotation2366893 1 BBa_E0040 range2366893 1 149 868 annotation2366891 1 BBa_M31985 range2366891 1 137 142 annotation2366890 1 BBa_B0034 range2366890 1 117 128 annotation2366901 1 BBa_B0015 range2366901 1 891 1019 annotation2366888 1 BBa_R0084 range2366888 1 1 108 annotation2366894 1 BBa_K150008 range2366894 1 877 882 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_M31985 1 BglII BglII restriction enzyme site 2007-02-28T12:00:00Z 2015-05-08T01:14:01Z none BglII restriction enzyme site false false _102_ 0 1373 102 Not in stock false none false Tiffany Guo BBa_E0040 1 GFP green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212 2004-09-29T11:00:00Z 2016-01-26T02:09:38Z Released HQ 2013 GFP (mut3b) [note that this part does not have a barcode] false true _11_1_ 4206 61 7 In stock false true jcbraff annotation1934520 1 GFP protein range1934520 1 1 720 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_R0084 1 OmpR Promoter (OmpR, positive) 2004-01-27T12:00:00Z 2015-05-08T01:14:15Z NC_000913 E. coli K12 Released HQ 2013 Positively regulated, OmpR-controlled promoter. This promoter is taken from the upstream region of ompF. Phosphorylated OmpR binds to the three operator sites and activates transcription. false false _1_ 0 24 7 In stock false The promoter includes three OmpR binding sites: F1, F2, and F3. The promoter starts at -107 and goes up to the transcriptional start site at +1. A distant fourth binding site, F4, has been deleted. It is involved in negative regulation of ompF (Head, Tardy and Kenney, 1998), so its deletion is intended to make the promoter solely activating. The efficacy of this promoter versus the ompC upstream region (BBa_R0082) or the truncated ompC upstream region (BBa_R0083) is currently unknown. true Stephen Lee, Roshan Kumar, Joe Levine, Ziyan Chu (Polkadorks, IAP 2004) annotation301313 1 F3 OmpR range301313 1 51 68 annotation301309 1 F2 OmpR range301309 1 31 48 annotation301317 1 -35 range301317 1 73 78 annotation301308 1 F1 OmpR range301308 1 11 28 annotation301318 1 -10 range301318 1 88 93 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_K150008 1 BamHI BamHI restriction enzyme site 2008-10-20T11:00:00Z 2015-05-08T01:10:46Z - BamHI restriction site false true _234_ 0 3299 9 Not in stock false - false Pascal Kraemer BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1173502_sequence 1 cttaaattttacttttggttacatattttttctttttgaaaccaaatctttatctttgtagcactttcacggtagcgaaacgttagtttgaatggaaagatgcctgcatactagagaaagaggagaaatactagagagatcttactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagggatcctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0034_sequence 1 aaagaggagaaa BBa_K150008_sequence 1 ggatcc BBa_E0040_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_M31985_sequence 1 agatct BBa_R0084_sequence 1 cttaaattttacttttggttacatattttttctttttgaaaccaaatctttatctttgtagcactttcacggtagcgaaacgttagtttgaatggaaagatgcctgca BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z