BBa_K1187001 1 BBa_K1187001 Human insulin gene, optimized for expression in Pichia pastoris 2013-09-16T11:00:00Z 2015-05-08T01:09:37Z Synthetic DNA from GeneArt?? | Life Technologies The sequence we used for insulin was obtained from NCBI. It is the coding sequence for human insulin. The sequence obtained from NCBI was codon optimized for use in P. pastoris utilizing IDT codon optimization software. Expressing and obtaining pure has insulin from Pichia cultures will reduce allergic responses, inconsistent purity and concentration, and host rejection in patients who take insulin as a treatment of type I and type II diabetes. false false _1500_ 0 17138 9 It's complicated false Optimized from human sequence for P. pastoris. false James Ellinger BBa_K1187001_sequence 1 atggctttgtggatgaggcttttacctctgttggcattattagctttgtggggtccagatcctgctgctgcctttgtaaaccaacatttgtgtggctcccacctggtcgaggccctttatttagtttgtggagaaagaggtttcttttacacacctaagacacgtagagaagccgaggatctacaggttggtcaagttgaactaggtggcggccctggggcaggtagtctacaacctctagcactggagggcagtctacagaagagaggaattgtagagcaatgctgtacttccatttgctccttgtatcaattggagaactactgtaactaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z