BBa_K1190000 1 BBa_K1190000 Melan-A (MART-1) 2013-08-29T11:00:00Z 2015-05-08T01:09:38Z Homo sapiens melanocytes Protein melan-A is a protein that in humans is encoded by the MLANA gene. A fragment of the protein, usually consisting of the nine amino acids 27 to 35, is bound by MHC class I complexes which present it to T cells of the immune system. These complexes can be found on the surface of melanoma cells. Decameric peptides (26-35) are being investigated as cancer vaccines. false false _1504_ 0 9215 9 In stock false The natural Melan-A sequence has a PstI site at 323bp. This can be remedied by creating a silent mutation to get rid of the PstI site. Because the epitope site is from amino acids 27-35 (81-105bp), it is also possible to shorten the sequence to less than 323 base pairs to exclude the PstI site altogether while retaining protein function as a vaccine candidate. false Nisarg Patel BBa_K1190000_sequence 1 atgccaagagaagatgctcacttcatctatggttaccccaagaaggggcacggccactcttacaccacggctgaagaggccgctgggatcggcatcctgacagtgatcctgggagtcttactgctcatcggctgttggtattgtagaagacgaaatggatacagagccttgatggataaaagtcttcatgttggcactcaatgtgccttaacaagaagatgcccacaagaagggtttgatcatcgggacagcaaagtgtctcttcaagagaaaaactgtgaacctgtggttcccaatgctccacctgcttatgagaaactctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z