BBa_K119002 1 BBa_K119002 RcnR operator (represses RcnA) 2008-09-27T11:00:00Z 2015-05-08T01:09:38Z E.coli genome Operator for RcnR(YohL) the negative regulator of niquel extrusion pump(RcnA) in E.coli false false _235_ 0 3054 9 It's complicated false We needed the RcnR operator without its promoter, so it was necessary to predict the promoter and discard it from the sequence. false Libertad Pantoja annotation1977507 1 RcnRop range1977507 1 1 83 BBa_K119002_sequence 1 cactattaatctactggggggtagtatcaggtactgggggggagtagaatcagattgccgaattaatactaagaattattatc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z