BBa_K1202107 1 BBa_K1202107 TAT-E4-orf4: Cancer killing peptide 2013-09-23T11:00:00Z 2015-05-08T01:09:40Z This part was prepared from Human Adenovirus Type 2. This part has two component. Tat: Tat protein is entering into this complex to the cell owing to dissolving cell membrane. E4ORF4: E4ORF4 is killing cancer cell owing to forcing cancer cells to apoptosis. false false _1516_ 0 17058 9 It's complicated true Due to the rare codon analysis, codon optimization is performed for this part. Codons are optimized for E.coli. false Muhammed Taha Akcay annotation2369190 1 RBS range2369190 1 36 47 annotation2369191 1 J23100 range2369191 1 1 35 annotation2369195 1 Linker range2369195 1 105 149 annotation2369194 1 TAT range2369194 1 69 104 annotation2369193 1 His tag range2369193 1 51 68 annotation2369196 1 E4orf4 range2369196 1 150 491 annotation2369197 1 Stop Codon range2369197 1 492 497 annotation2369192 1 Start Codon range2369192 1 48 50 BBa_K1202107_sequence 1 ttgacggctagctcagtcctaggtacagtgctagcaaagaggagaaaatgcatcaccatcatcaccatatgtatggtcgtaaaaaacgtcgtcagcgtcgtcgtggtggtggtggcagcggtggcggtggtagtggcggtggcggtagcatggttctgccggcactgccggcaccgccggtttgtgatagccagaatgaatgtgttggttggctgggtgttgcatatagcgcagttgttgatgttattcgtgcagccgcacatgaaggtgtttatattgaaccggaagcacgtggtcgcctggatgcactgcgtgaatggatttattataattattataccgaacgtgcaaaacgtcgtgatcgtcgtcgtcgtagcgtttgtcatgcacgtacctggttttgttttcgtaaatatgattatgttcgtcgtagcatttggcatgataccaccaccaataccattagcgttgttagcgcacatagcgttcagtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z