BBa_K1218001 1 BBa_K1218001 This is the sacY promoter. 2013-08-18T11:00:00Z 2015-05-08T01:09:42Z From Bacillus subtilis. This part is the sacY promoter, isolated from the genome of Bacillus subtilis. SacY is a regulator of sucrose induction. false false _1532_ 0 18104 9 In stock false Used oligos ordered from ElimBio. false Ravali Reddy BBa_K1218001_sequence 1 tatggcgggattgtgactgggcaggcaggcaagacccaatgat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z