BBa_K122007 1 BBa_K122007 pTet - amber suppressor tRNA 2008-10-24T11:00:00Z 2015-05-08T01:09:42Z Gene Synthesis by SOEing Supf tRNA transcript under constitutive repressible transcription (replace with tyrosine) false false _218_ 0 3326 9 Not in stock false SupF+ false David Ouyang BBa_K122007_sequence 1 gggaattcgcggccgcttctagagttgatatgatgcgccccgcttcccgataagggagcaggccagtaaaagcattacctgtggtggggttcccgagcggccaaagggagcagactctaaatctgccgtcatcgacttcgaaggttcgaatccttcccccaccaccatcactttcaaaagtccgaaagtactagtagcggccgctgcaggg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z