BBa_K1230000 1 MarA AcrAB-TolC multidrug efflux transport system activator from E. coli 2013-09-07T11:00:00Z 2015-05-08T01:09:44Z Synthesis from genscript The MarA protein acts as a transcriptional activator in E. coli, it allows the expression of the acrAB and tolC operons, which activate the AcrAB-TolC efflux pump, a mechanism that has been related with resistance to organic solvents, dyes, detergents, antibiotics such as chloramphenicol, tetracycline, novobiocin, erythromycin, fusidic acid and cloxacillin, as well as to cationic antimicrobial peptides, such as LL-37, HNP-2 and HBD-1. false false _1544_ 0 17080 9 It's complicated false Silent mutation (G->C) at base 132 to remove AarI and BspMI sites. false Andr??s Ferri??o Iriarte annotation2335365 1 MarA range2335365 1 1 393 annotation2335366 1 stop range2335366 1 388 393 annotation2335368 1 G to C mutation range2335368 1 132 132 annotation2335367 1 start range2335367 1 1 3 BBa_K1230000_sequence 1 atgacgatgtccagacgcaatactgacgctattaccattcatagcattttggactggatcgaggacaacctggaatcgccactgtcactggagaaagtgtcagagcgttcgggttactccaaatggcacctccaacggatgtttaaaaaagaaaccggtcattcattaggccaatacatccgcagccgtaagatgacggaaatcgcgcaaaagctgaaggaaagtaacgagccgatactctatctggcagaacgatatggcttcgagtcgcaacaaactctgacccgaaccttcaaaaattactttgatgttccgccgcataaataccggatgaccaatatgcagggcgaatcgcgctttttacatccattaaatcattacaacagctaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z