BBa_K1231005 1 BBa_K1231005 Asr-128-Lpp-RBS-GFP 2013-09-29T11:00:00Z 2015-05-08T01:09:44Z Genomic Sequence Plasmid from Jewett Labb This dual-state construct has a 128 base pair space between the two promoters. false false _1545_ 0 18772 9 It's complicated false N/A false Brendan Tran component2366882 1 BBa_K1231002 component2366881 1 BBa_K1231000 annotation2366882 1 BBa_K1231002 range2366882 1 149 238 annotation2366881 1 BBa_K1231000 range2366881 1 1 140 BBa_K1231002 1 BBa_K1231002 Lpp-RBS is a constitutive promoter 2013-09-16T11:00:00Z 2015-05-08T01:09:44Z Used PCR to extract the promoter from a plasmid obtained from Northwestern University's Jewett Lab. Lpp-RBS is a constitutive promoter that is constantly initiating transcription at low levels. false false _1545_ 0 18772 9 In stock false N/A false Brendan Tran BBa_K1231000 1 BBa_K1231000 The asr promoter is a pH-responsive promoter. 2013-09-12T11:00:00Z 2015-05-08T01:09:44Z E. coli This part contains the asr promoter with its native RBS. The asr promoter is a pH-responsive promoter native to E. coli. It induces transcription in acidic conditions (~pH 5.5). false false _1545_ 0 18773 9 In stock false None. false Viral Patel BBa_K1231002_sequence 1 ggtttcccgactggaatcaaaaaaatattctcaacataaaaaactttgtgtaatacttgtgaaataattttgtttaactttaagaaggag BBa_K1231005_sequence 1 cgctgtaatttattcagcgtttgtacatatcgttacacgctgaaaccaaccactcacggaagtctgccattcccagggatatagttatttcaacggccccgcagtggggttaaatgaaaaaacaaattgagggtatgacatactagagggtttcccgactggaatcaaaaaaatattctcaacataaaaaactttgtgtaatacttgtgaaataattttgtttaactttaagaaggag BBa_K1231000_sequence 1 cgctgtaatttattcagcgtttgtacatatcgttacacgctgaaaccaaccactcacggaagtctgccattcccagggatatagttatttcaacggccccgcagtggggttaaatgaaaaaacaaattgagggtatgaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z