BBa_K125100 1 BBa_K125100 nir promoter from <I>Synechocystis</I> sp. PCC6803 2008-07-23T11:00:00Z 2015-05-08T01:09:44Z The ''nirA'' promoter originates from ''Synechocystis'' sp. PCC6803. The ''nir'' promoter is nitrate inducible. false false _ 0 3229 9 It's complicated false false Krystle Salazar and Grace Kwan annotation1968488 1 Ntc-B binding motif range1968488 1 5 20 annotation1968487 1 -10 sequence range1968487 1 73 78 annotation1968489 1 Ntc-A binding motif range1968489 1 36 44 annotation1968486 1 nir promoter range1968486 1 1 88 BBa_K125100_sequence 1 gctaaatgcgtaaactgcatatgccttcgctgagtgtaatttacgttacaaattttaacgaaacgggaaccctatattgatctctact igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z