BBa_K125300 1 pilA1 SS pilA1 signal sequence from cyanobacterium Synechocystis; secretes protein 2008-07-24T11:00:00Z 2015-05-08T01:09:44Z The ''pilA'' signal sequence is found at the amino terminal of ''pilA'' polypeptides synthesized by ''Synechocystis'' sp. PCC6803. ''pilA'' is a pilin protein known to be secreted by the cyanobacteria ''Synechocystis'' sp. PCC6803. false false _179_ 0 3229 9 In stock false true Krystle Salazar and Grace Kwan annotation1968258 1 pilA signal sequence range1968258 1 1 62 BBa_K125300_sequence 1 tggctagtaattttaaattcaaactcctctctcaactctccaaaaaacgggcagaaggtggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z