BBa_K125340 1 OriV Origin of Vegetative Replication 2008-08-28T11:00:00Z 2015-05-08T01:09:45Z This part is taken from the RSF1010 derived plasmid pRL1383a. A description of this plasmid can be found at the NCBI database at accession number AF403426. Plasmids containing oriV and the corresponding Rep proteins (from RSF1010) are autonomously replicated in a broad range of hosts. It has been reported that RSF1010 derived plasmids containing oriV and the Rep proteins are stably maintained in Pseudomonas (Bagdasarian 1981), Caulobacter (Umelo-Njaka et al. 2001), Erwinia, Serratia (Leemans 1987), and several cyanobacteria strains (Mermet-Bouvier 1993) including Synechocystis PCC6803 and PCC6714 and Synechococcus PCC7942 and PCC6301. false false _179_ 0 3138 9 Not in stock false This part is to be constructed with the Rep proteins derived from an RSF1010 plasmid. false Margaret Ruzicka annotation1974216 1 RepA Binding Site range1974216 1 353 401 annotation1974214 1 RepC Binding Site range1974214 1 3 66 annotation1974215 1 RepB Binding Site range1974215 1 207 352 BBa_K125340_sequence 1 aacccctgcaataactgtcacgcccccctgcaataactgtcacgaacccctgcaataactgtcacgcccccaaacctgcaaacccagcaggggcgggggctggcggggtgttggaaaaatccatccatgattatctaagaataatccactaggcgcggttatcagcgcccttgtggggcgctgctgcccttgcccaatatgcccggccagaggccggatagctggtctattcgctgcgctaggctacacaccgccccaccgctgcgcggcagggggaaaggcgggcaaagcccgctaaaccccacaccaaaccccgcagaaatacgctggagcgcttttagccgctttagcggcctttccccctacccgaagggtgggggcgcgtgtgcagccccgcagggcctgtctcggtcgatcattcagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z