BBa_K1315008 1 BBa_K1315008 The <i>cblD</i> promoter from <i>Burkholderia</i> 2014-09-25T11:00:00Z 2015-05-08T01:09:50Z The source of this part is Burkholderia cenocepacia J2315 genomic DNA which was provided by the Robert Ryan lab in the Molecular Microbiology department of the University of Dundee, UK. This is a promoter that is activated by the OmpR-like two-component response regulator BCAM0228 (Bba_K1315007) in the BCAM0227-BCAM0228 sensor system. The Burkholderia diffusible signal (BDSF) is being picked up by the BCAM0227 sensor kinase that is hypothesised to eventually lead in involvement of BCAM0228. BCAM0228 is then activating cblD. false false _1690_ 0 21812 9 In stock false The sequence did not have any restriction sites to remove so it was immediately PCRed out of the genome and had the registry prefix and suffix added to it. It was then ligated into the pSB1C3 vector false Dimitrios Michailidis annotation2387049 1 cblD range2387049 1 1 250 BBa_K1315008_sequence 1 gaagcgccagcaggacgtgctgatgatggtcggcaaggtgcgctgcgaagtggccgggccggatgcgttgccggagtcgctgcgaaagcaggcccgcgtgcgcaagctgctggagcatcgctacgtgatgtcgatgcgggggccgaccgcgggcgtgaccgactcgtcgcagtgacgcacacgacgtgtgccggcaggcaccgcgcgttgccgcttgcgatgccgaaaacacaaggaaacaaccattcat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z