BBa_K1318000 1 CcdB CcdB toxin 2014-10-01T11:00:00Z 2015-07-09T11:28:18Z E. coli fertility factor (F plasmid) CcdB is a toxin that poisons and kills E. coli by inhibiting the DNA gyrase and inducing double strand breaks. CcdB activity can be inhibited by the CcdA antitoxin. This gene is under the control of a galactose inducible promoter true false _1693_ 4206 20061 9 In stock true CcdB is toxic so it has to be expressed in conjunction with CcdA or not on a galactose-containing medium. false Laurence Van Melderen annotation2416918 1 CcdB stop range2416918 1 307 309 annotation2416917 1 CcdB start range2416917 1 1 3 annotation2416919 1 CcdB range2416919 1 1 309 BBa_K1318000_sequence 1 atgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z