BBa_K1319007 1 BBa_K1319007 6xHis tag with double stop codon 2014-09-24T11:00:00Z 2015-05-08T01:09:50Z The part was designed using the histidin codon CAC and the double stop codons TAA-TAA. This part is a C-terminal 6xHis-tag with a double stop-codon. It can be fused to the C-terminus of proteins to enable purification of fully-translated proteins. false false _1694_ 0 19522 9 Not in stock false In contrast to other 6x-His tag parts, this part uses the standard double stop codon TAA-TAA. false Michael Osthege annotation2386538 1 6xHis range2386538 1 1 24 BBa_K1319007_sequence 1 caccaccaccaccaccactaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z