BBa_K1321005 1 BBa_K1321005 Synthetic Phytochelatin EC(20) RFC[25] 2014-10-06T11:00:00Z 2015-05-08T01:09:51Z Sequence is not natural. Basis for the sequence was from the following reference: Bae W, Chen W, Mulchandani A, Mehra RK (2000) Enhanced bioaccumulation of heavy metals by bacterial cells displaying synthetic phytochelatins. Biotechnol Bioeng. 70(5):518-24. Synthetic Phytochelatin EC(20) rfc25 fusion format false false _1696_ 0 20780 9 In stock true Codon optimised for E.coli. false Xenia Spencer-Milnes annotation2414598 1 Synthetic Phytochelatin EC(20) range2414598 1 1 123 BBa_K1321096 1 BBa_K1321096 Linker-CBDcipA-Linker + Phytochelatin (PC) EC20 2014-10-16T11:00:00Z 2015-06-17T12:35:09Z Please see part pages for the composite parts Synthetic phytochelatin EC20 (metal binding peptide) fused C-terminally to CBDcipA (a cellulose-binding domain), which contains an endogenous N and C-terminal linker sequence. At present the site-directed mutagenesis for this construct is in progress to correct an illegal EcoRI site which was identified in the CBDcipA. This construct is part of a library of fusions with cellulose binding domains which we designed to bind to cellulose and enable capture of heavy metals ([http://2014.igem.org/Team:Imperial/Functionalisation project page]). Other fusion parts with this metal binding protein can be seen in the table below: [[File:IC14-PC-part-table.PNG]] Note that the start and stop codon, plus 6 bp either side of the sequence, are included the RFC25 prefix and suffix which is not shown. false false _1696_ 4206 20780 9 Not in stock false The linker sequences mean fusions should be fine either N or N-terminally to the CBDcipA false Xenia Spencer-Milnes component2423605 1 BBa_B0105 component2423607 1 BBa_K1321005 component2423603 1 BBa_K1321014 annotation2423607 1 BBa_K1321005 range2423607 1 718 840 annotation2423603 1 BBa_K1321014 range2423603 1 1 711 annotation2423605 1 BBa_B0105 range2423605 1 712 717 BBa_B0105 1 Scar 25 RFC 25 Scar Sequence 2009-10-14T11:00:00Z 2015-08-31T04:07:21Z BBF RFC 25 This is the scar produced by assembly using RFC 25. If you are assembling a composite part using RFC 25, you can insert this part and specify blunt assembly to get the desired sequence. false false _1_ 0 25 397 Not in stock false Simple DNA sequence false Randy Rettberg annotation2041621 1 Scar 25 range2041621 1 1 6 BBa_K1321014 1 BBa_K1321014 CBDCipA with N and C-terminal linker 2014-10-14T11:00:00Z 2015-06-17T12:14:33Z The designed construct was ordered from as a GeneArt?? String (Invitrogen??? Life Technologies). This CBD is from the Cellulosomal -scaffolding protein A (cipA) of Clostridium thermocellum including the endogenous linker sequences at the N and C-terminus (UniProt ID Q06851 link http://www.uniprot.org/uniprot/Q06851). It is in RFC25 format to allow for easy use in protein fusions. The CBD is part of the CBM3 family (link to cazy http://www.cazy.org/CBM3.html). This CBD has been used in many application: in fusions with cell adhesion peptides to enhance the properties of cellulose as a cell-growth matrix (Andrade <i>et al </i> 2010a, Andrade <i>et al </i> 2010b), fused to enzymes to remove contaminants from water (Kauffmann <i> et al </i> 2000) and fused to an antimicrobial peptide (Ramos, Domingues & Gama 2010). At present the cloning for these constructs is still in progress to correct an illegal EcoRI site which was identified in the parts with this CBD. This can be achieved with a silent mutation via site-directed mutagenesis and we aim to send these parts to the registry once this is complete. false false _1696_ 4206 20780 9 Not in stock true The DNA sequence from the relevant portion of http://www.ncbi.nlm.nih.gov/nuccore/144777 was codon optimised for ''E.coli''. RFC[25] prefix and suffix were appended to the sequence with an additional 4 basepairs (gatc) at the beginning and end to allow space for the restriction enzymes to bind to the EcoRI and PstI sites at the ends of the sequence for cloning purposes. false Xenia Spencer-Milnes annotation2420186 1 CBDcipA range2420186 1 127 603 annotation2420187 1 Endogenous Linker (C-term) range2420187 1 604 711 annotation2420141 1 Endogenous Linker (N-term) range2420141 1 1 126 BBa_K1321096_sequence 1 aatgctacgccaactaagggtgcaaccccgaccaacacagcaacgcctacaaaaagcgctacagcaacacctacaagaccgtcagttcctacaaacacaccgactaacacaccggcaaatacacctgtttcaggcaacttgaaggtcgaattctataactcaaatccgagtgatacaactaacagtattaatccgcagtttaaagtaacaaatacaggatcaagtgcaattgatctttcaaagcttacattgagatactattacaccgttgatggccagaaggaccagactttctggtgtgaccatgcagctatcataggtagcaacggctcatacaacggcatcacatcaaatgtaaaaggaacattcgtaaagatgagctcaagcacaaataacgcagacacatacctcgaaataagtttcacaggtggcactttggaacctggtgctcatgtacagatacagggtaggtttgcgaaaaatgactggagtaattatacacagtcaaatgattactcatttaagtcagcatcacagttcgtagaatgggatcaggttacagcatatttgaatggagtacttgtatggggtaaagaaccaggaggatcagtagttccgtcaacacagccggtaacaaccccaccggcaacaaccaagccgccagcaacaaccaaaccaccggctaccacgattcctccatcagacgatccgaccggcgaatgtgaatgtgagtgcgaatgcgagtgtgaatgtgagtgtgagtgtgaatgtgaatgcgagtgtgagtgcgagtgcgaatgtgagtgtgaatgcgagtgcgaatgcgaatgcgagtgcggc BBa_B0105_sequence 1 accggc BBa_K1321005_sequence 1 gaatgtgaatgtgagtgcgaatgcgagtgtgaatgtgagtgtgagtgtgaatgtgaatgcgagtgtgagtgcgagtgcgaatgtgagtgtgaatgcgagtgcgaatgcgaatgcgagtgcggc BBa_K1321014_sequence 1 aatgctacgccaactaagggtgcaaccccgaccaacacagcaacgcctacaaaaagcgctacagcaacacctacaagaccgtcagttcctacaaacacaccgactaacacaccggcaaatacacctgtttcaggcaacttgaaggtcgaattctataactcaaatccgagtgatacaactaacagtattaatccgcagtttaaagtaacaaatacaggatcaagtgcaattgatctttcaaagcttacattgagatactattacaccgttgatggccagaaggaccagactttctggtgtgaccatgcagctatcataggtagcaacggctcatacaacggcatcacatcaaatgtaaaaggaacattcgtaaagatgagctcaagcacaaataacgcagacacatacctcgaaataagtttcacaggtggcactttggaacctggtgctcatgtacagatacagggtaggtttgcgaaaaatgactggagtaattatacacagtcaaatgattactcatttaagtcagcatcacagttcgtagaatgggatcaggttacagcatatttgaatggagtacttgtatggggtaaagaaccaggaggatcagtagttccgtcaacacagccggtaacaaccccaccggcaacaaccaagccgccagcaacaaccaaaccaccggctaccacgattcctccatcagacgatccg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z