BBa_K1321011 1 BBa_K1321011 SmtA metallothionein in Freiburg format (RFC[25]) 2014-10-09T11:00:00Z 2015-05-08T01:09:51Z Source from BBa_____ SmtA metallothionein in rfc25 format. This part is based on BBa_____ but has been codon optimised for E.coli and is in the rfc25 biobrick format for ease of use as part of protein fusions. This part is available as fusions as follows: false false _1696_ 0 20780 9 Not in stock false Codon optimised for E.coli. rbs not included in the part as it is for fusions false Xenia Spencer-Milnes annotation2414600 1 SmtA range2414600 1 1 165 BBa_K1321120 1 BBa_K1321120 SmtA metallothionein fused to linker-dCBD 2014-10-08T11:00:00Z 2015-06-17T12:22:14Z GATC GATC false false _1696_ 4206 20961 9 In stock false GATC false Gabriella Santosa component2414677 1 BBa_B0105 component2414679 1 BBa_K1321340 component2414675 1 BBa_K1321011 annotation2414675 1 BBa_K1321011 range2414675 1 1 165 annotation2414677 1 BBa_B0105 range2414677 1 166 171 annotation2414679 1 BBa_K1321340 range2414679 1 172 537 BBa_K1321340 1 BBa_K1321340 Double CBD (dCBD) with N-terminal linker 2014-10-07T11:00:00Z 2015-06-17T12:14:46Z asdf dCBD with N-terminal linker. false false _1696_ 4206 20830 9 In stock true asdf false Chris N Micklem annotation2417848 1 Linker range2417848 1 1 72 annotation2417850 1 Linker range2417850 1 187 258 annotation2417851 1 cbh1 CBD range2417851 1 259 366 annotation2417847 1 dCBD range2417847 1 1 366 annotation2417849 1 cbh2 CBD range2417849 1 73 186 BBa_B0105 1 Scar 25 RFC 25 Scar Sequence 2009-10-14T11:00:00Z 2015-08-31T04:07:21Z BBF RFC 25 This is the scar produced by assembly using RFC 25. If you are assembling a composite part using RFC 25, you can insert this part and specify blunt assembly to get the desired sequence. false false _1_ 0 25 397 Not in stock false Simple DNA sequence false Randy Rettberg annotation2041621 1 Scar 25 range2041621 1 1 6 BBa_K1321011_sequence 1 accagcaccaccctggttaaatgtgcatgtgaaccgtgtctgtgtaatgttgatccgagcaaagcaattgatcgcaatggtctgtattattgtagcgaagcatgtgcagatggtcatacaggtggtagcaaaggttgtggtcataccggctgtaattgtcatggc BBa_B0105_sequence 1 accggc BBa_K1321340_sequence 1 cccggcgccaatccgcccggtactacgaccacttcgcgtccagcaaccacgaccgggtcgagccccggcccacaggcctgttcttccgtctggggtcagtgcggcggacagaactggtctggccctacctgctgtgcttctggcagcacatgcgtctactctaacgactactatagccagtgcctgccgggtgctaacccgccaggcactaccactacctctcgccccgctaccactacaggctctagcccgggacctacccaaagccactacggccagtgcggaggcattggctacagcggccctaccgtctgcgcctccggaaccacctgccaagtcctgaacccgtactactcccagtgtctt BBa_K1321120_sequence 1 accagcaccaccctggttaaatgtgcatgtgaaccgtgtctgtgtaatgttgatccgagcaaagcaattgatcgcaatggtctgtattattgtagcgaagcatgtgcagatggtcatacaggtggtagcaaaggttgtggtcataccggctgtaattgtcatggcaccggccccggcgccaatccgcccggtactacgaccacttcgcgtccagcaaccacgaccgggtcgagccccggcccacaggcctgttcttccgtctggggtcagtgcggcggacagaactggtctggccctacctgctgtgcttctggcagcacatgcgtctactctaacgactactatagccagtgcctgccgggtgctaacccgccaggcactaccactacctctcgccccgctaccactacaggctctagcccgggacctacccaaagccactacggccagtgcggaggcattggctacagcggccctaccgtctgcgcctccggaaccacctgccaagtcctgaacccgtactactcccagtgtctt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z