BBa_K1321338 1 BBa_K1321338 T7 Expression vector 2014-10-07T11:00:00Z 2015-05-08T01:09:53Z asdf asdfasdf false false _1696_ 0 20830 9 In stock false asdf false Chris N Micklem component2402301 1 BBa_B0034 component2402299 1 BBa_I719005 annotation2402301 1 BBa_B0034 range2402301 1 32 43 annotation2402299 1 BBa_I719005 range2402299 1 1 23 BBa_K1321011 1 BBa_K1321011 SmtA metallothionein in Freiburg format (RFC[25]) 2014-10-09T11:00:00Z 2015-05-08T01:09:51Z Source from BBa_____ SmtA metallothionein in rfc25 format. This part is based on BBa_____ but has been codon optimised for E.coli and is in the rfc25 biobrick format for ease of use as part of protein fusions. This part is available as fusions as follows: false false _1696_ 0 20780 9 Not in stock false Codon optimised for E.coli. rbs not included in the part as it is for fusions false Xenia Spencer-Milnes annotation2414600 1 SmtA range2414600 1 1 165 BBa_I719005 1 pT7 T7 Promoter 2007-10-23T11:00:00Z 2015-08-31T04:07:53Z --- Released HQ 2013 Just a T7 Promoter false false _128_ 0 2097 9 In stock true None true Imperial 2007 BBa_K1321138 1 BBa_K1321138 Metallothionein SmtA with T7 promoter 2014-10-08T11:00:00Z 2015-05-08T01:09:52Z GATC GATC false false _1696_ 0 20961 9 In stock false GATC false Gabriella Santosa component2414813 1 BBa_K1321338 component2414817 1 BBa_K1321011 component2414815 1 BBa_K1319106 annotation2414817 1 BBa_K1321011 range2414817 1 59 223 annotation2414813 1 BBa_K1321338 range2414813 1 1 43 annotation2414815 1 BBa_K1319106 range2414815 1 44 58 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1319106 1 Scar25 ATG RFC 25 Translation Start Scar Sequence 2014-10-02T11:00:00Z 2015-05-08T01:09:51Z This sequence is produced by an assembly method. This sequence is produced by RFC10-assembly of a RFC10-RBS with a RFC25-prefixed part. false false _1694_ 0 19522 9 Not in stock false The resulting sequence is a combination of the RFC10 RBS-CDS scar (tactag) and 9 nucleotides from the RFC25 prefix (atg gcc ggc). false Michael Osthege annotation2393317 1 start range2393317 1 7 9 BBa_K1321011_sequence 1 accagcaccaccctggttaaatgtgcatgtgaaccgtgtctgtgtaatgttgatccgagcaaagcaattgatcgcaatggtctgtattattgtagcgaagcatgtgcagatggtcatacaggtggtagcaaaggttgtggtcataccggctgtaattgtcatggc BBa_I719005_sequence 1 taatacgactcactatagggaga BBa_B0034_sequence 1 aaagaggagaaa BBa_K1321338_sequence 1 taatacgactcactatagggagatactagagaaagaggagaaa BBa_K1321138_sequence 1 taatacgactcactatagggagatactagagaaagaggagaaatactagatggccggcaccagcaccaccctggttaaatgtgcatgtgaaccgtgtctgtgtaatgttgatccgagcaaagcaattgatcgcaatggtctgtattattgtagcgaagcatgtgcagatggtcatacaggtggtagcaaaggttgtggtcataccggctgtaattgtcatggc BBa_K1319106_sequence 1 tactagatggccggc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z