BBa_K1321152 1 BBa_K1321152 metallothionein Fmt fused to CBDcex 2014-10-08T11:00:00Z 2015-06-17T12:23:40Z GATC GATC false false _1696_ 4206 20961 9 In stock false GATC false Gabriella Santosa component2415040 1 BBa_K1321003 component2415039 1 BBa_B0105 component2415037 1 BBa_K1321012 annotation2415039 1 BBa_B0105 range2415039 1 199 204 annotation2415040 1 BBa_K1321003 range2415040 1 205 531 annotation2415037 1 BBa_K1321012 range2415037 1 1 198 BBa_K1321012 1 BBa_K1321012 fMT metallothionein in Freiburg format (RFC[25]) 2014-10-09T11:00:00Z 2015-05-08T01:09:51Z From part BBa___ except codon optimised fMT metallothionein in rfc25 format. This part is based on BBa_____. It can be found as fusions in the following parts: false false _1696_ 0 20780 9 Not in stock false From part BBa___ except codon optimised false Xenia Spencer-Milnes annotation2414611 1 fMT range2414611 1 1 198 BBa_B0105 1 Scar 25 RFC 25 Scar Sequence 2009-10-14T11:00:00Z 2015-08-31T04:07:21Z BBF RFC 25 This is the scar produced by assembly using RFC 25. If you are assembling a composite part using RFC 25, you can insert this part and specify blunt assembly to get the desired sequence. false false _1_ 0 25 397 Not in stock false Simple DNA sequence false Randy Rettberg annotation2041621 1 Scar 25 range2041621 1 1 6 BBa_K1321003 1 BBa_K1321003 Re-entry of BBa_K863101, Cellulose Binding Domain CBDcex in rfc25 2014-10-09T11:00:00Z 2015-06-17T12:35:33Z This is a direct copy of BBa_K863101 with slight modifications to the beginning and end of the sequence for the purposes of allowing composite parts to be added correctly using this part. This part is a copy of BBa_K863101 (Cellulose binding Domain of Cellulomonas Fimi Exoglucanse (Freiburg-Standard)) and was created only as a registry entry, removing the atg-NgoMIV parts at the front and the AgeI-taa basepairs from the sequence so that the registry does not flag it as rfc25 incompatible, and it enables us to enter fusion proteins with this part as automatic composite parts in the method as described by: http://2009.igem.org/Team:Freiburg_bioware/general. false false _1696_ 4206 20780 9 Not in stock false This is a direct copy of BBa_K863101 with slight modifications to the beginning and end of the sequence for the purposes of allowing composite parts to be added correctly using this part. false Xenia Spencer-Milnes BBa_B0105_sequence 1 accggc BBa_K1321003_sequence 1 ggtccggccgggtgccaggtgctgtggggcgtcaaccagtggaacaccggcttcaccgcgaacgtcaccgtgaagaacacgtcctccgctccggtagacggctggacgctcacgttcagcttcccgtccggccagcaggtcacccaggcgtggagctcgacggtcacgcagtccggctcggccgtgacggtccgcaacgccccgtggaacggctcgatcccggcgggcggcaccgcgcagttcggcttcaacggctcgcacacgggcaccaacgccgcgccgacggcgttctcgctcaacggcacgccctgcacggtcggcggcagc BBa_K1321012_sequence 1 gcaggtacaggttgtaaaatttgggaagattgtaaatgtggtgcagcatgtagctgtggtgatagctgtacctgtggcaccgttaaaaaaggtacaaccagccgtgccggtgcaggttgtccgtgtggtccgaaatgtaaatgtacaggtcagggtagctgtaactgcgttaaagatgattgttgtggttgtggcaaa BBa_K1321152_sequence 1 gcaggtacaggttgtaaaatttgggaagattgtaaatgtggtgcagcatgtagctgtggtgatagctgtacctgtggcaccgttaaaaaaggtacaaccagccgtgccggtgcaggttgtccgtgtggtccgaaatgtaaatgtacaggtcagggtagctgtaactgcgttaaagatgattgttgtggttgtggcaaaaccggcggtccggccgggtgccaggtgctgtggggcgtcaaccagtggaacaccggcttcaccgcgaacgtcaccgtgaagaacacgtcctccgctccggtagacggctggacgctcacgttcagcttcccgtccggccagcaggtcacccaggcgtggagctcgacggtcacgcagtccggctcggccgtgacggtccgcaacgccccgtggaacggctcgatcccggcgggcggcaccgcgcagttcggcttcaacggctcgcacacgggcaccaacgccgcgccgacggcgttctcgctcaacggcacgccctgcacggtcggcggcagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z