BBa_K1321009 1 BBa_K1321009 Nickel Binding Protein (NiBP) Freiburg format (RFC[25]) 2014-10-07T11:00:00Z 2015-05-08T01:09:51Z This part is based on the existing BioBrick BBa_K1151001 by the 2013 Salente Lecce iGEM team. Nickel Binding Protein in Freiburg format (RFC 25) to allow for easy use in fusion proteins. false false _1696_ 0 20830 9 In stock false OEPCR primers were designed to allow for the replacement of the standard BioBrick prefix and suffix with the Freiburg prefix and suffix. false Chris N Micklem annotation2416941 1 Nickel Binding Protein range2416941 1 1 176 BBa_K1321343 1 BBa_K1321343 NiBP fused to CBDclos in RFC 25 2014-10-07T11:00:00Z 2015-06-17T12:26:16Z asdf adsdf false false _1696_ 4206 20830 9 In stock false asdf false Chris N Micklem component2415101 1 BBa_K1321002 component2415100 1 BBa_B0105 component2415098 1 BBa_K1321009 annotation2415100 1 BBa_B0105 range2415100 1 177 182 annotation2415098 1 BBa_K1321009 range2415098 1 1 176 annotation2415101 1 BBa_K1321002 range2415101 1 183 482 BBa_K1321002 1 BBa_K1321002 Re-entry of BBa_K863111, Cellulose Binding Domain CBDclos in rfc25 2014-10-09T11:00:00Z 2015-06-17T12:35:41Z This is a direct copy of BBa_K863111 with slight modifications to the beginning and end of the sequence for the purposes of allowing composite parts to be added correctly using this part. This part is a copy of BBa_K863111 (Cellulose binding domain of C. cellulovorans cellulose binding protein gene (Freiburg-Standard)) and was created only as a registry entry, removing the atg-NgoMIV parts at the front and the AgeI-taa basepairs from the sequence so that the registry does not flag it as rfc25 incompatible, and it enables us to enter fusion proteins with this part as automatic composite parts in the method as described by: http://2009.igem.org/Team:Freiburg_bioware/general. false false _1696_ 4206 20780 9 Not in stock false This is a direct copy of BBa_K863111 with slight modifications to the beginning and end of the sequence for the purposes of allowing composite parts to be added correctly using this part. false Xenia Spencer-Milnes BBa_B0105 1 Scar 25 RFC 25 Scar Sequence 2009-10-14T11:00:00Z 2015-08-31T04:07:21Z BBF RFC 25 This is the scar produced by assembly using RFC 25. If you are assembling a composite part using RFC 25, you can insert this part and specify blunt assembly to get the desired sequence. false false _1_ 0 25 397 Not in stock false Simple DNA sequence false Randy Rettberg annotation2041621 1 Scar 25 range2041621 1 1 6 BBa_B0105_sequence 1 accggc BBa_K1321343_sequence 1 gcacaccatgaagaacaacacggcggacaccaccaccatcaccatcacaacaccaccaccactaccatggcggcgaacaccaccatcaccaccacagctctcatcatgaagaaggttgttgtagcactagcgatagtcatcatcaagaagaaggttgctgccacgggcatcacgagaccggctcatcaatgtcagttgaattttacaactctaacaaatcagcacaaacaaactcaattacaccaataatcaaaattactaacacgtctgacagtgatttaaatttaaatgacgtaaaagttagatattattacacaagtgatggtacacaaggacaaactttctggtgtgaccatgctggtgcattattaggaaatagctatgttgataacactagcaaagtgacagcaaacttcgttaaagaaacagcaagcccaacatcaacctatgatacatatgttgaatttggatttgcaggcagc BBa_K1321002_sequence 1 tcatcaatgtcagttgaattttacaactctaacaaatcagcacaaacaaactcaattacaccaataatcaaaattactaacacgtctgacagtgatttaaatttaaatgacgtaaaagttagatattattacacaagtgatggtacacaaggacaaactttctggtgtgaccatgctggtgcattattaggaaatagctatgttgataacactagcaaagtgacagcaaacttcgttaaagaaacagcaagcccaacatcaacctatgatacatatgttgaatttggatttgcaggcagc BBa_K1321009_sequence 1 gcacaccatgaagaacaacacggcggacaccaccaccatcaccatcacaacaccaccaccactaccatggcggcgaacaccaccatcaccaccacagctctcatcatgaagaaggttgttgtagcactagcgatagtcatcatcaagaagaaggttgctgccacgggcatcacgag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z