BBa_K1321009 1 BBa_K1321009 Nickel Binding Protein (NiBP) Freiburg format (RFC[25]) 2014-10-07T11:00:00Z 2015-05-08T01:09:51Z This part is based on the existing BioBrick BBa_K1151001 by the 2013 Salente Lecce iGEM team. Nickel Binding Protein in Freiburg format (RFC 25) to allow for easy use in fusion proteins. false false _1696_ 0 20830 9 In stock false OEPCR primers were designed to allow for the replacement of the standard BioBrick prefix and suffix with the Freiburg prefix and suffix. false Chris N Micklem annotation2416941 1 Nickel Binding Protein range2416941 1 1 176 BBa_K1321344 1 BBa_K1321344 NiBP fused to CBDcex in RFC 25 2014-10-07T11:00:00Z 2015-06-17T12:26:09Z asdf asdf false false _1696_ 4206 20830 9 In stock false asdf false Chris N Micklem component2415106 1 BBa_B0105 component2415107 1 BBa_K1321003 component2415104 1 BBa_K1321009 annotation2415104 1 BBa_K1321009 range2415104 1 1 176 annotation2415107 1 BBa_K1321003 range2415107 1 183 509 annotation2415106 1 BBa_B0105 range2415106 1 177 182 BBa_B0105 1 Scar 25 RFC 25 Scar Sequence 2009-10-14T11:00:00Z 2015-08-31T04:07:21Z BBF RFC 25 This is the scar produced by assembly using RFC 25. If you are assembling a composite part using RFC 25, you can insert this part and specify blunt assembly to get the desired sequence. false false _1_ 0 25 397 Not in stock false Simple DNA sequence false Randy Rettberg annotation2041621 1 Scar 25 range2041621 1 1 6 BBa_K1321003 1 BBa_K1321003 Re-entry of BBa_K863101, Cellulose Binding Domain CBDcex in rfc25 2014-10-09T11:00:00Z 2015-06-17T12:35:33Z This is a direct copy of BBa_K863101 with slight modifications to the beginning and end of the sequence for the purposes of allowing composite parts to be added correctly using this part. This part is a copy of BBa_K863101 (Cellulose binding Domain of Cellulomonas Fimi Exoglucanse (Freiburg-Standard)) and was created only as a registry entry, removing the atg-NgoMIV parts at the front and the AgeI-taa basepairs from the sequence so that the registry does not flag it as rfc25 incompatible, and it enables us to enter fusion proteins with this part as automatic composite parts in the method as described by: http://2009.igem.org/Team:Freiburg_bioware/general. false false _1696_ 4206 20780 9 Not in stock false This is a direct copy of BBa_K863101 with slight modifications to the beginning and end of the sequence for the purposes of allowing composite parts to be added correctly using this part. false Xenia Spencer-Milnes BBa_B0105_sequence 1 accggc BBa_K1321344_sequence 1 gcacaccatgaagaacaacacggcggacaccaccaccatcaccatcacaacaccaccaccactaccatggcggcgaacaccaccatcaccaccacagctctcatcatgaagaaggttgttgtagcactagcgatagtcatcatcaagaagaaggttgctgccacgggcatcacgagaccggcggtccggccgggtgccaggtgctgtggggcgtcaaccagtggaacaccggcttcaccgcgaacgtcaccgtgaagaacacgtcctccgctccggtagacggctggacgctcacgttcagcttcccgtccggccagcaggtcacccaggcgtggagctcgacggtcacgcagtccggctcggccgtgacggtccgcaacgccccgtggaacggctcgatcccggcgggcggcaccgcgcagttcggcttcaacggctcgcacacgggcaccaacgccgcgccgacggcgttctcgctcaacggcacgccctgcacggtcggcggcagc BBa_K1321003_sequence 1 ggtccggccgggtgccaggtgctgtggggcgtcaaccagtggaacaccggcttcaccgcgaacgtcaccgtgaagaacacgtcctccgctccggtagacggctggacgctcacgttcagcttcccgtccggccagcaggtcacccaggcgtggagctcgacggtcacgcagtccggctcggccgtgacggtccgcaacgccccgtggaacggctcgatcccggcgggcggcaccgcgcagttcggcttcaacggctcgcacacgggcaccaacgccgcgccgacggcgttctcgctcaacggcacgccctgcacggtcggcggcagc BBa_K1321009_sequence 1 gcacaccatgaagaacaacacggcggacaccaccaccatcaccatcacaacaccaccaccactaccatggcggcgaacaccaccatcaccaccacagctctcatcatgaagaaggttgttgtagcactagcgatagtcatcatcaagaagaaggttgctgccacgggcatcacgag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z