BBa_K1332009 1 BBa_K1332009 mRNA circularization device (3?? side) (endless translation) 2014-09-25T11:00:00Z 2015-09-17T07:37:20Z The 5??? side of the intron from td gene of T4 phage without stop codon is BBa_K1332003. A double terminator is BBa_B0015. This part consists of the 5??? side of the intron from td gene of T4 phage without stop codon and a double terminator. false false _1707_ 20591 21011 9 In stock true Nothing false Kenta Nomura BBa_K1332009_sequence 1 cagagatgttttcttgggttaattgaggcctgagtataaggtgacttatacttgtaatctatctaaacggggaacctctctagtagacaatcccgtgctaaattgtaggacttactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z