BBa_K1343000 1 BBa_K1343000 P_tet->NheI->RBS->luxI->double terminator 2014-09-21T11:00:00Z 2015-05-08T01:09:59Z P_tet: BBa_I759002- we used only the promoter, without the rest of the part (spacer (including the RBS)-cro complex) and added few bp as a spacer. RBS: BBa_B0030. luxI: BBa_C0061 but we removed the LVA tag and added stop codon: "tag". Double terminator BBa_B0015 This part generates AHL (Source organism: V. fischeri). The promoter is P_tet which induced by Tetracycline or by its analog anhydrotetracycline (aTc). Before the promoter there is the prefix site and after the promoter there is a restriction site of NheI, so the promoter can be replaced by a restriction enzyme reaction. In addition, after the NheI restriction site, there is an RBS and luxI which is coding to AHL. At the end of the part, there is double terminator and the Suffix site. false false _1718_ 0 20627 9 It's complicated true The part has been sequenced and has been checked with a detector strain which detects AHL and produce color. We know for sure that it produces AHL. false Shira Attias annotation2384874 1 Double terminator range2384874 1 673 801 annotation2384872 1 luxI range2384872 1 91 672 annotation2384866 1 NheI range2384866 1 64 69 annotation2384865 1 P_tet range2384865 1 1 63 annotation2384871 1 spacer range2384871 1 70 90 BBa_K1343000_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacgtgcacaacgctagcattaaagaggagaaaccccccatgactataatgataaaaaaatcggattttttggcaattccatcggaggagtataaaggtattctaagtcttcgttatcaagtgtttaagcaaagacttgagtgggacttagttgtagaaaataaccttgaatcagatgagtatgataactcaaatgcagaatatatttatgcttgtgatgatactgaaaatgtaagtggatgctggcgtttattacctacaacaggtgattatatgctgaaaagtgtttttcctgaattgcttggtcaacagagtgctcccaaagatcctaatatagtcgaattaagtcgttttgctgtaggtaaaaatagctcaaagataaataactctgctagtgaaattacaatgaaactatttgaagctatatataaacacgctgttagtcaaggtattacagaatatgtaacagtaacatcaacagcaatagagcgatttttaaagcgtattaaagttccttgtcatcgtattggagacaaagaaattcatgtattaggtgatactaaatcggttgtattgtctatgcctattaatgaacagtttaaaaaagcagtcttaaattagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z