BBa_K115008 1 BBa_K115008 RNA thermometer (ROSE) 2008-08-17T11:00:00Z 2015-05-08T01:09:28Z This sequence is taken from the Bradirhizobium Japonicum (BA000040.) as the 5'UTR (ROSE) of a heat shock protein. This is a RNA-thermometer derived from ROSE (BBa_K115001), to check effect of small changes in RNA-sequence on temperature sensitivity false false _223_ 0 3007 9 In stock true A few nucleotides have been altered true O.M.J.A. Stassen annotation1971992 1 Predicted stem loop range1971992 1 15 36 annotation1971994 1 Predicted stem loop extending to start codon range1971994 1 71 96 annotation1971996 1 Scar adaptation range1971996 1 74 80 annotation1971991 1 Predicted stem loop range1971991 1 1 15 annotation1971993 1 Predicted stem loop range1971993 1 38 71 annotation1971995 1 SD range1971995 1 89 95 BBa_K1344006 1 BBa_K1344006 J23100-ROSE 2014-10-04T11:00:00Z 2015-05-08T01:10:00Z From the registry This part will make the gene of interest translated only at 42C false false _1719_ 0 20150 9 It's complicated false It will make regulatory translation false UI Indonesia 2014 component2394143 1 BBa_J23100 component2394150 1 BBa_K115008 annotation2394150 1 BBa_K115008 range2394150 1 44 139 annotation2394143 1 BBa_J23100 range2394143 1 1 35 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_K1344006_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagaggccgcgacaagcggtccgggcgccctaggggcccggcggagacgggcgccggaggtgtccgacgcctgctcgtcaagtacttgctccttggaggat BBa_K115008_sequence 1 gccgcgacaagcggtccgggcgccctaggggcccggcggagacgggcgccggaggtgtccgacgcctgctcgtcaagtacttgctccttggaggat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z