BBa_K1351003 1 BBa_K1351003 Laminin-derived peptide binding to NADH Oxidase of S. pneumoniae 2014-10-02T11:00:00Z 2015-06-01T12:53:36Z The part was generated by annealing of artificially synthesized oligonucletides: L5P_ENX_SD_Ngo_precutEP_fwd: AATTCgcggccgctTCTAGAgtaaggaggaaGCCGGCATG TGTCAAGAATGTTCACCGGGATTT ACCGGTtaatACTAGTagcggccgCTGCA L5P_SNP_Age_precutEP_rev: GcggccgctACTAGTattaACCGGT AAATCCCGGTGAACATTCTTGACA CATGCCGGCttcctccttacTCTAGAagcggccgcG Short peptide of 9 amino acids corresponding to amino acids 661 to 668 of the human protein Laminin (subunit alpha-5, UniProt [http://www.uniprot.org/uniprot/O15230 O15230]). It has been shown to bind to NADH oxidase (NOX) of ''Streptococcus pneumoniae'' and inhibit bacterial binding to human A549 cells (Muchnik ''et. al.'', 2013). Displayed on the surface of ''Bacillus subtilis'', it should enable ''B. subtilis'' to bind specifically to ''S. pneumoniae''. This part was generated in a modified version of RFC25, where a strong Shine Dalgarno Sequence (SD) is included, and has the following prefix and suffix: {| |prefix with EcoRI, NotI, XbaI, SD and NgoMIV: |<span style="color:blue">GAATTC</span><span style="color:green">GCGGCCGC</span>T<span style="color:red">TCTAGA</span>GT<u>AAGGAGG</u>A<span style="color:orange">GCCGGC</span> |- |suffix with AgeI, SpeI, NotI and PstI: |<span style="color:orange">ACCGGT</span><u>TAA</u>T<span style="color:red">AC<u>TAG</u><u>T</u></span><u>A</u><span style="color:green"><u>G</u>CGGCCGC</span><span style="color:blue">CTGCAG</span> |} Sites of restriction enzymes generating compatible overhangs have the same color: <span style="color:blue">EcoRI</span> and <span style="color:blue">PstI</span> in blue, <span style="color:green">NotI</span> in green, <span style="color:red">XbaI</span> and <span style="color:red">SpeI</span> in red, <span style="color:orange">NgoMIV</span> and <span style="color:orange">AgeI</span> in orange. Shine-Dalgarno sequence and stop codons are underlined. false false _1726_ 4206 20048 9 In stock false For generation of the part's nucleotide sequence, the amino acid sequence of the peptide (Muchnik et. al., 2013) was reverse transcribed with regard to the codon usage of Bacillus subtilis. Oligos were designed as precut by EcoRI and PstI to shorten the synthesized fragments and to simplify the cloning into pSB1C3. false Mona Dotzler BBa_K1351003_sequence 1 atgtgtcaagaatgttcaccgggattt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z