Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: Mona Dotzler
Date created: 2014-10-04 11:00:00
Date modified: 2015-06-01 12:55:40
Bacillus subtilis sortase YhcS
| Types | DnaRegion |
| Roles | CDS Coding |
| Sequences | BBa_K1351011_sequence (Version 1) |
Description
Bacillus subtilis sortase YhcS (UniProt P54603), responsible for anchoring its substrae YhcR (UniProt P54602) covalently to the peptidoglycan wall of B. subtilis.A YhcR-based surface display system has been shown to covalently anchor heterologous proteins to the B. subtilis cell wall (Liew et. al., 2012). It was used in the BaKillus project to display pathogen-specific peptides and mediate adhesion of B. subtlis to pathogens.
It consists of four components: the sortase substrate with a signal peptide (this part), a linker (BBa_K1351009) and a cell wall-anchoring domain (BBa_K1351010) as well as the sortase YhcS itself (BBa_K1351011), whose overexpression increases the efficiency of the surface display.
This part was generated in a modified version of RFC25, where a strong Shine Dalgarno Sequence (SD) is included, and has the following prefix and suffix:
{|
|prefix with EcoRI, NotI, XbaI, SD and NgoMIV:
|GAATTCGCGGCCGCTTCTAGAGTAAGGAGGAGCCGGC
|-
|suffix with AgeI, SpeI, NotI and PstI:
|ACCGGTTAATACTAGTAGCGGCCGCCTGCAG
|}
Sites of restriction enzymes generating compatible overhangs have the same color:
EcoRI and PstI in blue, NotI in green, XbaI and SpeI in red, NgoMIV and AgeI in orange. Shine-Dalgarno sequence and stop codons are underlined.
Notes
noneSource
This part was generated by amplification from B. subtilis W168 gDNA with the primers listed below, followed by digestion with EcoRI and PstI and ligation into pSB1C3.YhcS_ENX_SD_Ngo_fwd: gatcGAATTCgcggccgctTCTAGAgtaaggaggaaGCCGGC GTGAAAAAAGTTATTCCACTATTCATCATTGC
YhcS_SNP_rev: gatcCTGCAGcggccgctACTAGTa TTAAGTCACTCGTTTTCCATATATAATATAGCG
An EcoRI site was removed by changing T to C at position 399 without altering the protein sequence by fusion PCR with the following mutagenesis primers:
YhcS_EcoRI435mut_fwd: CGTCTTCTCCTGTCATATGGAGAATTtACATATGAAATTGTAAAAACAAAAATTGTCG
YhcS_EcoRI435mut_rev: CGACAATTTTTGTTTTTACAATTTCATATGTaAATTCTCCATATGACAGGAGAAGACG