BBa_K1351018 1 BBa_K1351018 Promoter for the sdpIR operon 2014-09-14T11:00:00Z 2015-06-01T08:14:47Z Bacillus subtilis gDNA (W168) Biobrick flanked Promoter sequence. The Promoter regulates the sdpI (immunity against the cannibalism toxin sdpC) and the regulator sdpR in bacillus subtilis. false false _1726_ 4206 20046 9 In stock false No false Philipp Popp & Roman Herzog BBa_K1351018_sequence 1 gggttgtttttaaaaaaattcaagttataatgaaaataatacatttatacaaatatctaaatgtctaaatgttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z