BBa_K1351022 1 BBa_K1351022 FsrA: Fur-regulated sRNA which binds the binding site sdhC 2014-09-30T11:00:00Z 2015-05-08T01:10:01Z gDNA Regulatory rRNA wich binds the binding site sdhC??. Idea was, sdhC??between promoter and gene therefor when fsrA is expressed it should bind the sdhC?? sequence and the transcription of the gene behind sdhC?? is blocked. false false _1726_ 0 20046 9 In stock false None false Philipp Popp & Roman Herzog BBa_K1351022_sequence 1 aggagagaagctactctctgttccccaacccctctatcagatcaagatccgaaaaaacttggcgctacccccgccaagttttttatttgtcaaagcataggacaatccaata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z