BBa_K1351024 1 BBa_K1351024 P_<i>comC</i>, a CSP inducible promoter derived from <i>Streptococcus pneumoniae</i> 2014-10-05T11:00:00Z 2015-06-01T08:16:55Z gDNA from Streptococcus pneumoniae R6 CSP-depending promoter of Streptococcus pneumoniae. This part was generated in a modified version of RFC25, where a strong Shine Dalgarno Sequence (SD) is included, and has the following prefix and suffix: <br> {| |prefix with EcoRI, NotI, XbaI, SD and NgoMIV: |<span style="color:blue">GAATTCC</span><span style="color:green">GCGGCCGC</span>T<span style="color:red">TCTAGA</span>T<u>AAGGAGG</u>A<span style="color:orange">GCCGGC</span> |- |suffix with AgeI, SpeI, NotI and PstI: |<span style="color:orange">ACCGGT</span><u>TAA</u>T<span style="color:red">AC<u>TAG</u><u>T</u></span><u>A</u><span style="color:green"><u>G</u>CGGCCG</span><span style="color:blue">CTGCAG</span> |} Sites of restriction enzymes generating compatible overhangs have the same color:<br> <span style="color:blue">EcoRI</span> and <span style="color:blue">PstI</span> in blue, <span style="color:green">NotI</span> in green, <span style="color:red">XbaI</span> and <span style="color:red">SpeI</span> in red, <span style="color:orange">NgoMIV</span> and <span style="color:orange">AgeI</span> in orange. Shine-Dalgarno sequence and stop codons are underlined. <br> false false _1726_ 4206 20370 9 In stock true none false Judith Heckmann annotation2397926 1 ComE binding site Right range2397926 1 79 87 annotation2397925 1 ComE binding site Left range2397925 1 58 66 BBa_K1351024_sequence 1 ctgggatcaatataatagcaaagctgggaattttcccggcttttttcttaaaaaagtacactttgggagaaaaaaatgacagttgagagaattttatctaaaacgaaattccattttgtataatggtttttgtaagttagcttacaagaaaaaacatttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z