BBa_K136000 1 BBa_K136000 Promoter of fliL gene from E. coli flagella 2008-08-11T11:00:00Z 2015-05-08T01:10:02Z This part comes from the genome of ''E.coli'' K12 strain MG1655. ''fliL'' is a class 2 gene that is part of the construction of the flagella ( ''Ordering Genes in a Flagella Pathway by Analysis of Expression Kinetics from Living Bacteria'' - S. Kalir, J. McClure, K. Pabbaraju, C. Southward, M. Ronen, S. Leibler, M. G. Surette, U. Alon, ). Its promoter is consitutively repressed. It is activated by flhD<sub>4</sub>C<sub>2</sub> and by fliA with different forces ( ''Using a Quantitative Blueprint to Reprogram the Dynamics of the Flagella Gene Network'' - Shiraz Kalir and Uri Alon ). A deeper characterization is in project true false _211_ 0 3012 9 Discontinued false The primers used to amplify this sequence are : Forward : TCGAATTCGCGGCCGCTTCTAGAGCAAGGGCGTGTAACAGGCAAC Reverse : TCCTGCAGCGGCCGCTACTAGTAGTCATGTGTTGCGGTCTTCCTGTG false Cyprien Maisonnier annotation1971564 1 FlhDC binding site 1 range1971564 1 44 59 annotation1971567 1 Initiation start for transcription 2 range1971567 1 127 127 annotation1971566 1 Initiation start for transcription 1 range1971566 1 116 116 annotation1971565 1 FlhDC binding site 2 range1971565 1 70 85 BBa_K136000_sequence 1 caagggcgtgtaacaggcaacagcggcgttgatattttcgcctaacgtcagaggtagcaccgtaatccgcgtcttttccccgctttgttgcgctcaagacgcaggataattagccgataagcagtagcgacacaggaagaccgcaacacatgac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z