BBa_K1362452 1 TEV clv. TEV protease recognition/cleavage site 2014-10-07T11:00:00Z 2015-05-08T01:10:06Z Tobacco Etch Virus This part codes for the amino acid sequence ENLYFQG. This site is recognized by TEV protease (catalytic domain of the Tobacco Etch Virus nuclear inclusion a (NIa) protein), which will cleave the Gln-Gly peptide bond [[{{PAGENAME}}:Design#References|[1]]]. The final four nucleotides of this sequence are GGGT, which will be the overhang produced wenn a reverse-facing BsaI site (<partinfo>BBa_K1362423</partinfo>, <partinfo>BBa_K1362427</partinfo>, <partinfo>BBa_K1362447</partinfo>) is directly following this part, as in the Sortase A circularization constructs (<partinfo>BBa_K1362202</partinfo>, <partinfo>BBa_K1362203</partinfo>, <partinfo>BBa_K1362204</partinfo>, <partinfo>BBa_K1362205</partinfo>). false false _1738_ 0 22951 9 Not in stock false false Constantin Ahlmann-Eltze, Charlotte Bunne, Magdalena B&uuml;scher, Jan Gleixner, Max Horn, Anna Huhn, Nils Klughammer, Jakob Kreft, Elisabeth Sch&auml;fer, Carolin Schmelas, Silvan Schmitz, Max Waldha BBa_J70594 1 BBa_J70594 RFC12 TAATAA Tail Domain 2010-06-17T11:00:00Z 2015-05-08T01:08:25Z Common Knowledge A RFC12 compatible part that simply codes for two stop codons. This part does not have any degradation tag. false true _41_ 0 6384 41 Not in stock false Made with synthetic oligos: 5' AATTC GCGGCGC T ACTAGT TAATAA GCTAGC A GCGGCCG CTGCA 3' 5' GCGGCCGCTGCTAGC TTATTA ACTAGTAGCGCCGC G 3' Note that both primers were ordered phosphorylated. An alternative is to phosphorylate the primers yourself with a kinase. false Joseph Lynch annotation2071257 1 stop range2071257 1 1 5 BBa_K1362002 1 CircSortA Sortase A circularization construct (with His6) 2014-10-08T11:00:00Z 2015-05-08T01:10:04Z TODO TODO false false _1738_ 0 22951 9 Not in stock false TODO false Silvan Schmitz component2409389 1 BBa_K1362090 component2409416 1 BBa_K1362202 annotation2409416 1 BBa_K1362202 range2409416 1 36 1192 annotation2409389 1 BBa_K1362090 range2409389 1 1 29 BBa_K1362202 1 BBa_K1362202 Sortase A circularization construct (with His6; without RBS) 2014-10-06T11:00:00Z 2015-05-08T01:10:05Z TODO TODO false false _1738_ 0 22951 9 In stock false TODO false Constantin Ahlmann-Eltze, Charlotte Bunne, Magdalena B&uuml;scher, Jan Gleixner, Max Horn, Anna Huhn, Nils Klughammer, Jakob Kreft, Elisabeth Sch&auml;fer, Carolin Schmelas, Silvan Schmitz, Max Waldha component2410787 1 BBa_K1362457 component2410786 1 BBa_K1362454 component2410764 1 BBa_K1362445 component2410789 1 BBa_J70594 component2410766 1 BBa_K1362427 component2410765 1 BBa_K1362452 component2410785 1 BBa_K1362424 component2410784 1 BBa_J04450 annotation2410786 1 BBa_K1362454 range2410786 1 1116 1133 annotation2410785 1 BBa_K1362424 range2410785 1 1109 1115 annotation2410764 1 BBa_K1362445 range2410764 1 1 12 annotation2410766 1 BBa_K1362427 range2410766 1 34 39 annotation2410787 1 BBa_K1362457 range2410787 1 1134 1151 annotation2410789 1 BBa_J70594 range2410789 1 1152 1157 annotation2410784 1 BBa_J04450 range2410784 1 40 1108 annotation2410765 1 BBa_K1362452 range2410765 1 13 33 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 annotation1961227 1 start range1961227 1 173 173 annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961225 1 -10 range1961225 1 161 166 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961224 1 -35 range1961224 1 137 142 annotation1961223 1 CAP binding site range1961223 1 89 126 BBa_K1362445 1 MGSS Start codon and GSS spacer 2014-10-07T11:00:00Z 2015-05-08T01:10:06Z designed manually This part codes for the protein sequence MGSS. false false _1738_ 0 22951 9 Not in stock false false Constantin Ahlmann-Eltze, Charlotte Bunne, Magdalena B&uuml;scher, Jan Gleixner, Max Horn, Anna Huhn, Nils Klughammer, Jakob Kreft, Elisabeth Sch&auml;fer, Carolin Schmelas, Silvan Schmitz, Max Waldha BBa_K1362454 1 SortA clv. Sortase A recognition/cleavage site 2014-10-07T11:00:00Z 2015-05-08T01:10:06Z 'Staphylococcus aureus'' This part codes for the amino acid sequence LPETGG. This site is recognized by Sortase A, which will cleave the Thr-Gly peptide bond and subsequently act as a transpeptidase to attach any peptide with an N-terminal glycine [[{{PAGENAME}}:Design#References|[1]]]. The first four nucleotides of this sequence are CTTC, which will be the overhang produced wenn a forward-facing BsaI site (<partinfo>BBa_K1362424</partinfo>, <partinfo>BBa_K1362425</partinfo>) is directly following this part, as in the Sortase A circularization constructs (<partinfo>BBa_K1362202</partinfo>, <partinfo>BBa_K1362203</partinfo>, <partinfo>BBa_K1362204</partinfo>, <partinfo>BBa_K1362205</partinfo>). false false _1738_ 0 22951 9 Not in stock false false Constantin Ahlmann-Eltze, Charlotte Bunne, Magdalena B&uuml;scher, Jan Gleixner, Max Horn, Anna Huhn, Nils Klughammer, Jakob Kreft, Elisabeth Sch&auml;fer, Carolin Schmelas, Silvan Schmitz, Max Waldha BBa_J04450 1 BBa_J04450 RFP Coding Device 2005-06-08T11:00:00Z 2015-08-31T04:08:14Z Davidson Synth-Aces Released HQ 2013 Contains an IPTG inducible promoter an RBS, RFP, and terminator. false true _16_ 0 328 16 In stock false true Tamar Odle component1509417 1 BBa_B0010 component1509411 1 BBa_E1010 component1509404 1 BBa_B0034 component1509394 1 BBa_R0010 component1509427 1 BBa_B0012 annotation1509417 1 BBa_B0010 range1509417 1 941 1020 annotation1509404 1 BBa_B0034 range1509404 1 209 220 annotation1509411 1 BBa_E1010 range1509411 1 227 907 annotation1509394 1 BBa_R0010 range1509394 1 1 200 annotation1509427 1 BBa_B0012 range1509427 1 1029 1069 BBa_K1362090 1 T7 RBS strong T7 RBS 2014-10-02T11:00:00Z 2015-05-08T01:10:04Z synthesized as found in the T7 genome and several commercial expression plasmids. RFC10 compatible strong RBS derived from the T7 phage gene 10a (major capsid protein)[1]. When assembled to a coding part with the A of the start codon being part of the XbaI site, the RBS will be shifted one bp downstream compared to the native sequence. The sequence was successfully used by the iGEM team Heidelberg 2014 for the expression of many proteins in E.coli. 1. Olinss, P. & Rangwala, S. H. Derived from Bacteriophage T7 mRNA Acts ELS an Enhancer of Translation of the lac2 Gene in. 16973???16976 (1989). false false _1738_ 0 22830 9 It's complicated false The 18 bp including the XbaI that can be found upstream of the presumably important part of the RBS were included into the sequence just to make sure it works. However to fully comply with RFC10 a G was inserted behind the XbaI site. false Constantin Ahlmann-Eltze, Charlotte Bunne, Magdalena B??scher, Jan Gleixner, Max Horn, Anna Huhn, Nils Klughammer, Jakob Kreft, Elisabeth Sch??fer, Carolin Schmelas, Silvan Schmitz, Max Waldha annotation2393796 1 Shine-Dalgarno range2393796 1 21 28 annotation2393795 1 t7 RBS range2393795 1 11 28 BBa_K1362427 1 <- BsaI BsaI reverse restriction site for RFC[???] cloning (shortened by one C) 2014-10-07T11:00:00Z 2015-05-08T01:10:05Z BsaI recognition sequence from rebase This Sequence starts with a part of the reverse-complemented BsaI recognition site. The missing C of the recognition site must be included in the downstream part. It contains a spacer thymidine so that BsaI will cut the bottom strand directly upstream and the top strand 4 nucleotides upstream. false false _1738_ 0 22951 9 Not in stock false false Constantin Ahlmann-Eltze, Charlotte Bunne, Magdalena B&uuml;scher, Jan Gleixner, Max Horn, Anna Huhn, Nils Klughammer, Jakob Kreft, Elisabeth Sch&auml;fer, Carolin Schmelas, Silvan Schmitz, Max Waldha BBa_E1010 1 mRFP1 **highly** engineered mutant of red fluorescent protein from Discosoma striata (coral) 2004-07-27T11:00:00Z 2015-08-31T04:07:26Z Campbell et al., PNAS v99 p7877 <a href="http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=12060735">URL</a> Released HQ 2013 monomeric RFP: Red Fluorescent Protein. Excitation peak: 584 nm Emission peak: 607 nm false false _11_1_ 0 52 7 In stock false TAATAA double stop codon added (DE). Four silent mutations made to remove three EcoRI sites and one PstI site: A28G, A76G, A349G, G337A. true Drew Endy annotation1014044 1 mrfp1 range1014044 1 1 675 annotation2214014 1 Help:Barcodes range2214014 1 682 706 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1362424 1 BsaI -> BsaI restriction site for RFC[105] cloning 2014-10-06T11:00:00Z 2015-05-08T01:10:05Z This standard restriction site sequence is used as part of the iGEM team Heidelberg 2014's Intein Toolbox [[#References|[1]]]. All associated standard sequences can be reviewed in RFC[???] This is the reverse complement of a BsaI restriction site headed by an Adenine as a spacer-base to separate the recognition sequence from the outward-lying cutting sequence. It was used by us for scarless golden-gate cloning to fuse inteins to other proteins and thereby implement a variety of possible port-translational modifications. false false _1738_ 0 12377 9 Not in stock false This part is only the sequence of a restriction site. It will not be sent in as physical DNA and was merely created to easily compose new parts in the RFC[???] standard. In the actual cloning process this sequence was and is recommended to be inserted with the according PCR primers. false Constantin Ahlmann-Eltze, Charlotte Bunne, Magdalena B??scher, Jan Gleixner, Max Horn, Anna Huhn, Nils Klughammer, Jakob Kreft, Elisabeth Sch??fer, Carolin Schmelas, Silvan Schmitz, Max Waldha BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K1362457 1 His6 Hexahistidine tag 2014-10-07T11:00:00Z 2015-05-08T01:10:06Z This part codes for a hexahistidine tag, which can be used in protein purification by affinity chromatography. false false _1738_ 0 22951 9 Not in stock false false Constantin Ahlmann-Eltze, Charlotte Bunne, Magdalena B&uuml;scher, Jan Gleixner, Max Horn, Anna Huhn, Nils Klughammer, Jakob Kreft, Elisabeth Sch&auml;fer, Carolin Schmelas, Silvan Schmitz, Max Waldha BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_J70594_sequence 1 taataa BBa_K1362445_sequence 1 atgggcagtagt BBa_B0034_sequence 1 aaagaggagaaa BBa_E1010_sequence 1 atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc BBa_K1362002_sequence 1 aataattttgtttaactttaagaaggagatactagatgggcagtagtgagaatctttacttccagggttgagaccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttataggtctcacttcctgaaactggtggtcatcaccatcaccatcactaataa BBa_K1362090_sequence 1 aataattttgtttaactttaagaaggaga BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1362457_sequence 1 catcaccatcaccatcac BBa_K1362454_sequence 1 cttcctgaaactggtggt BBa_K1362452_sequence 1 gagaatctttacttccagggt BBa_J04450_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1362427_sequence 1 tgagac BBa_K1362202_sequence 1 atgggcagtagtgagaatctttacttccagggttgagaccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttataggtctcacttcctgaaactggtggtcatcaccatcaccatcactaataa BBa_K1362424_sequence 1 ggtctca BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z